ID: 1041076468

View in Genome Browser
Species Human (GRCh38)
Location 8:54174558-54174580
Sequence TGCAAGAAATGCGGCAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041076468_1041076472 28 Left 1041076468 8:54174558-54174580 CCTGGGCTGCCGCATTTCTTGCA No data
Right 1041076472 8:54174609-54174631 CCAGGTTGTTTGAGAAATGCAGG No data
1041076468_1041076473 29 Left 1041076468 8:54174558-54174580 CCTGGGCTGCCGCATTTCTTGCA No data
Right 1041076473 8:54174610-54174632 CAGGTTGTTTGAGAAATGCAGGG No data
1041076468_1041076470 10 Left 1041076468 8:54174558-54174580 CCTGGGCTGCCGCATTTCTTGCA No data
Right 1041076470 8:54174591-54174613 CGCAGTTCTCGCGTCTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041076468 Original CRISPR TGCAAGAAATGCGGCAGCCC AGG (reversed) Intergenic
No off target data available for this crispr