ID: 1041081703

View in Genome Browser
Species Human (GRCh38)
Location 8:54220821-54220843
Sequence TAAAATAAGACAGCCAGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041081703_1041081708 10 Left 1041081703 8:54220821-54220843 CCATGCCTGGCTGTCTTATTTTA No data
Right 1041081708 8:54220854-54220876 TTTATTTACAGATTGAGGTGGGG No data
1041081703_1041081705 5 Left 1041081703 8:54220821-54220843 CCATGCCTGGCTGTCTTATTTTA No data
Right 1041081705 8:54220849-54220871 ATTTCTTTATTTACAGATTGAGG No data
1041081703_1041081707 9 Left 1041081703 8:54220821-54220843 CCATGCCTGGCTGTCTTATTTTA No data
Right 1041081707 8:54220853-54220875 CTTTATTTACAGATTGAGGTGGG No data
1041081703_1041081706 8 Left 1041081703 8:54220821-54220843 CCATGCCTGGCTGTCTTATTTTA No data
Right 1041081706 8:54220852-54220874 TCTTTATTTACAGATTGAGGTGG No data
1041081703_1041081709 28 Left 1041081703 8:54220821-54220843 CCATGCCTGGCTGTCTTATTTTA No data
Right 1041081709 8:54220872-54220894 TGGGGTTCCCTATGTTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041081703 Original CRISPR TAAAATAAGACAGCCAGGCA TGG (reversed) Intergenic
No off target data available for this crispr