ID: 1041081707

View in Genome Browser
Species Human (GRCh38)
Location 8:54220853-54220875
Sequence CTTTATTTACAGATTGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041081703_1041081707 9 Left 1041081703 8:54220821-54220843 CCATGCCTGGCTGTCTTATTTTA No data
Right 1041081707 8:54220853-54220875 CTTTATTTACAGATTGAGGTGGG No data
1041081704_1041081707 4 Left 1041081704 8:54220826-54220848 CCTGGCTGTCTTATTTTATTTTT No data
Right 1041081707 8:54220853-54220875 CTTTATTTACAGATTGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041081707 Original CRISPR CTTTATTTACAGATTGAGGT GGG Intergenic
No off target data available for this crispr