ID: 1041082542

View in Genome Browser
Species Human (GRCh38)
Location 8:54227174-54227196
Sequence CTTCCTCCACCTATGGAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041082542_1041082553 24 Left 1041082542 8:54227174-54227196 CCCTATTCCATAGGTGGAGGAAG No data
Right 1041082553 8:54227221-54227243 GGCCTGGGGTCACCCACAAAAGG No data
1041082542_1041082546 -10 Left 1041082542 8:54227174-54227196 CCCTATTCCATAGGTGGAGGAAG No data
Right 1041082546 8:54227187-54227209 GTGGAGGAAGAGACCACAGAGGG No data
1041082542_1041082552 10 Left 1041082542 8:54227174-54227196 CCCTATTCCATAGGTGGAGGAAG No data
Right 1041082552 8:54227207-54227229 GGGGTTGAGCAGCTGGCCTGGGG No data
1041082542_1041082550 8 Left 1041082542 8:54227174-54227196 CCCTATTCCATAGGTGGAGGAAG No data
Right 1041082550 8:54227205-54227227 GAGGGGTTGAGCAGCTGGCCTGG No data
1041082542_1041082547 -9 Left 1041082542 8:54227174-54227196 CCCTATTCCATAGGTGGAGGAAG No data
Right 1041082547 8:54227188-54227210 TGGAGGAAGAGACCACAGAGGGG No data
1041082542_1041082551 9 Left 1041082542 8:54227174-54227196 CCCTATTCCATAGGTGGAGGAAG No data
Right 1041082551 8:54227206-54227228 AGGGGTTGAGCAGCTGGCCTGGG No data
1041082542_1041082549 3 Left 1041082542 8:54227174-54227196 CCCTATTCCATAGGTGGAGGAAG No data
Right 1041082549 8:54227200-54227222 CCACAGAGGGGTTGAGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041082542 Original CRISPR CTTCCTCCACCTATGGAATA GGG (reversed) Intergenic
No off target data available for this crispr