ID: 1041086971

View in Genome Browser
Species Human (GRCh38)
Location 8:54265728-54265750
Sequence GGTTATTTTGGAGGGCAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041086966_1041086971 -4 Left 1041086966 8:54265709-54265731 CCATTAAAGTCAAAATATTGGTT No data
Right 1041086971 8:54265728-54265750 GGTTATTTTGGAGGGCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041086971 Original CRISPR GGTTATTTTGGAGGGCAAGG AGG Intergenic
No off target data available for this crispr