ID: 1041089273

View in Genome Browser
Species Human (GRCh38)
Location 8:54287147-54287169
Sequence TCCATGGATGTGACCTCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041089264_1041089273 12 Left 1041089264 8:54287112-54287134 CCCCAGCCCTTGATAACACCATT No data
Right 1041089273 8:54287147-54287169 TCCATGGATGTGACCTCTCTAGG No data
1041089265_1041089273 11 Left 1041089265 8:54287113-54287135 CCCAGCCCTTGATAACACCATTC No data
Right 1041089273 8:54287147-54287169 TCCATGGATGTGACCTCTCTAGG No data
1041089269_1041089273 -6 Left 1041089269 8:54287130-54287152 CCATTCTCCTTCCTATCTCCATG No data
Right 1041089273 8:54287147-54287169 TCCATGGATGTGACCTCTCTAGG No data
1041089267_1041089273 6 Left 1041089267 8:54287118-54287140 CCCTTGATAACACCATTCTCCTT No data
Right 1041089273 8:54287147-54287169 TCCATGGATGTGACCTCTCTAGG No data
1041089266_1041089273 10 Left 1041089266 8:54287114-54287136 CCAGCCCTTGATAACACCATTCT No data
Right 1041089273 8:54287147-54287169 TCCATGGATGTGACCTCTCTAGG No data
1041089263_1041089273 17 Left 1041089263 8:54287107-54287129 CCTTTCCCCAGCCCTTGATAACA No data
Right 1041089273 8:54287147-54287169 TCCATGGATGTGACCTCTCTAGG No data
1041089268_1041089273 5 Left 1041089268 8:54287119-54287141 CCTTGATAACACCATTCTCCTTC No data
Right 1041089273 8:54287147-54287169 TCCATGGATGTGACCTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041089273 Original CRISPR TCCATGGATGTGACCTCTCT AGG Intergenic
No off target data available for this crispr