ID: 1041089460

View in Genome Browser
Species Human (GRCh38)
Location 8:54288503-54288525
Sequence ATCAGGCTTTCCCTCCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041089460_1041089468 15 Left 1041089460 8:54288503-54288525 CCCTCAGGGAGGGAAAGCCTGAT No data
Right 1041089468 8:54288541-54288563 CGTAGCCCTGTGGGAGGCAAAGG No data
1041089460_1041089464 5 Left 1041089460 8:54288503-54288525 CCCTCAGGGAGGGAAAGCCTGAT No data
Right 1041089464 8:54288531-54288553 GAGATCCATGCGTAGCCCTGTGG No data
1041089460_1041089465 6 Left 1041089460 8:54288503-54288525 CCCTCAGGGAGGGAAAGCCTGAT No data
Right 1041089465 8:54288532-54288554 AGATCCATGCGTAGCCCTGTGGG No data
1041089460_1041089472 25 Left 1041089460 8:54288503-54288525 CCCTCAGGGAGGGAAAGCCTGAT No data
Right 1041089472 8:54288551-54288573 TGGGAGGCAAAGGCAGGAAGAGG No data
1041089460_1041089473 26 Left 1041089460 8:54288503-54288525 CCCTCAGGGAGGGAAAGCCTGAT No data
Right 1041089473 8:54288552-54288574 GGGAGGCAAAGGCAGGAAGAGGG 0: 3
1: 46
2: 633
3: 4591
4: 71893
1041089460_1041089469 19 Left 1041089460 8:54288503-54288525 CCCTCAGGGAGGGAAAGCCTGAT No data
Right 1041089469 8:54288545-54288567 GCCCTGTGGGAGGCAAAGGCAGG No data
1041089460_1041089466 9 Left 1041089460 8:54288503-54288525 CCCTCAGGGAGGGAAAGCCTGAT No data
Right 1041089466 8:54288535-54288557 TCCATGCGTAGCCCTGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041089460 Original CRISPR ATCAGGCTTTCCCTCCCTGA GGG (reversed) Intergenic
No off target data available for this crispr