ID: 1041091910

View in Genome Browser
Species Human (GRCh38)
Location 8:54309933-54309955
Sequence CTGTGAGGGGAAGAGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041091910_1041091919 24 Left 1041091910 8:54309933-54309955 CCTTCCTTCTCTTCCCCTCACAG No data
Right 1041091919 8:54309980-54310002 ACCCCAAAACAATTAATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041091910 Original CRISPR CTGTGAGGGGAAGAGAAGGA AGG (reversed) Intergenic
No off target data available for this crispr