ID: 1041091939

View in Genome Browser
Species Human (GRCh38)
Location 8:54310150-54310172
Sequence CCAGACCCACAGGTGGTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041091933_1041091939 27 Left 1041091933 8:54310100-54310122 CCTATCTAGGATCACCTGGGTTT No data
Right 1041091939 8:54310150-54310172 CCAGACCCACAGGTGGTTTAAGG No data
1041091934_1041091939 13 Left 1041091934 8:54310114-54310136 CCTGGGTTTAGCTTTTGCCAGAG No data
Right 1041091939 8:54310150-54310172 CCAGACCCACAGGTGGTTTAAGG No data
1041091935_1041091939 -4 Left 1041091935 8:54310131-54310153 CCAGAGCATTTTTTTTCTACCAG No data
Right 1041091939 8:54310150-54310172 CCAGACCCACAGGTGGTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041091939 Original CRISPR CCAGACCCACAGGTGGTTTA AGG Intergenic
No off target data available for this crispr