ID: 1041094019

View in Genome Browser
Species Human (GRCh38)
Location 8:54331473-54331495
Sequence CCTTCCTCTAGGGTGCTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041094019_1041094030 9 Left 1041094019 8:54331473-54331495 CCTCTGAGCACCCTAGAGGAAGG No data
Right 1041094030 8:54331505-54331527 CAGTTTAGCAAGGGGGTCAGGGG No data
1041094019_1041094031 16 Left 1041094019 8:54331473-54331495 CCTCTGAGCACCCTAGAGGAAGG No data
Right 1041094031 8:54331512-54331534 GCAAGGGGGTCAGGGGATGTAGG No data
1041094019_1041094033 23 Left 1041094019 8:54331473-54331495 CCTCTGAGCACCCTAGAGGAAGG No data
Right 1041094033 8:54331519-54331541 GGTCAGGGGATGTAGGAGGATGG No data
1041094019_1041094025 0 Left 1041094019 8:54331473-54331495 CCTCTGAGCACCCTAGAGGAAGG No data
Right 1041094025 8:54331496-54331518 AGAGTTTGGCAGTTTAGCAAGGG No data
1041094019_1041094032 19 Left 1041094019 8:54331473-54331495 CCTCTGAGCACCCTAGAGGAAGG No data
Right 1041094032 8:54331515-54331537 AGGGGGTCAGGGGATGTAGGAGG No data
1041094019_1041094027 2 Left 1041094019 8:54331473-54331495 CCTCTGAGCACCCTAGAGGAAGG No data
Right 1041094027 8:54331498-54331520 AGTTTGGCAGTTTAGCAAGGGGG No data
1041094019_1041094029 8 Left 1041094019 8:54331473-54331495 CCTCTGAGCACCCTAGAGGAAGG No data
Right 1041094029 8:54331504-54331526 GCAGTTTAGCAAGGGGGTCAGGG No data
1041094019_1041094024 -1 Left 1041094019 8:54331473-54331495 CCTCTGAGCACCCTAGAGGAAGG No data
Right 1041094024 8:54331495-54331517 GAGAGTTTGGCAGTTTAGCAAGG No data
1041094019_1041094028 7 Left 1041094019 8:54331473-54331495 CCTCTGAGCACCCTAGAGGAAGG No data
Right 1041094028 8:54331503-54331525 GGCAGTTTAGCAAGGGGGTCAGG No data
1041094019_1041094026 1 Left 1041094019 8:54331473-54331495 CCTCTGAGCACCCTAGAGGAAGG No data
Right 1041094026 8:54331497-54331519 GAGTTTGGCAGTTTAGCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041094019 Original CRISPR CCTTCCTCTAGGGTGCTCAG AGG (reversed) Intergenic
No off target data available for this crispr