ID: 1041106926

View in Genome Browser
Species Human (GRCh38)
Location 8:54453696-54453718
Sequence AGTCGCCCGCTGCCAGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041106912_1041106926 27 Left 1041106912 8:54453646-54453668 CCTGTGCAAATCCCAGGCGGGGC No data
Right 1041106926 8:54453696-54453718 AGTCGCCCGCTGCCAGGGAGGGG No data
1041106921_1041106926 5 Left 1041106921 8:54453668-54453690 CCAAGCGGGAACGGGGACACGGT No data
Right 1041106926 8:54453696-54453718 AGTCGCCCGCTGCCAGGGAGGGG No data
1041106915_1041106926 16 Left 1041106915 8:54453657-54453679 CCCAGGCGGGGCCAAGCGGGAAC No data
Right 1041106926 8:54453696-54453718 AGTCGCCCGCTGCCAGGGAGGGG No data
1041106916_1041106926 15 Left 1041106916 8:54453658-54453680 CCAGGCGGGGCCAAGCGGGAACG No data
Right 1041106926 8:54453696-54453718 AGTCGCCCGCTGCCAGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041106926 Original CRISPR AGTCGCCCGCTGCCAGGGAG GGG Intergenic
No off target data available for this crispr