ID: 1041107012

View in Genome Browser
Species Human (GRCh38)
Location 8:54454028-54454050
Sequence GCGGGCGGGAGGGGAGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041107012_1041107031 21 Left 1041107012 8:54454028-54454050 CCTTACACTCCCCTCCCGCCCGC No data
Right 1041107031 8:54454072-54454094 ACCCACGGGGTACTGGCCCGGGG No data
1041107012_1041107022 6 Left 1041107012 8:54454028-54454050 CCTTACACTCCCCTCCCGCCCGC No data
Right 1041107022 8:54454057-54454079 CGACCTCCATCCTGGACCCACGG No data
1041107012_1041107023 7 Left 1041107012 8:54454028-54454050 CCTTACACTCCCCTCCCGCCCGC No data
Right 1041107023 8:54454058-54454080 GACCTCCATCCTGGACCCACGGG No data
1041107012_1041107024 8 Left 1041107012 8:54454028-54454050 CCTTACACTCCCCTCCCGCCCGC No data
Right 1041107024 8:54454059-54454081 ACCTCCATCCTGGACCCACGGGG No data
1041107012_1041107020 -2 Left 1041107012 8:54454028-54454050 CCTTACACTCCCCTCCCGCCCGC No data
Right 1041107020 8:54454049-54454071 GCGACCTTCGACCTCCATCCTGG No data
1041107012_1041107034 27 Left 1041107012 8:54454028-54454050 CCTTACACTCCCCTCCCGCCCGC No data
Right 1041107034 8:54454078-54454100 GGGGTACTGGCCCGGGGACAAGG No data
1041107012_1041107029 19 Left 1041107012 8:54454028-54454050 CCTTACACTCCCCTCCCGCCCGC No data
Right 1041107029 8:54454070-54454092 GGACCCACGGGGTACTGGCCCGG No data
1041107012_1041107030 20 Left 1041107012 8:54454028-54454050 CCTTACACTCCCCTCCCGCCCGC No data
Right 1041107030 8:54454071-54454093 GACCCACGGGGTACTGGCCCGGG No data
1041107012_1041107027 14 Left 1041107012 8:54454028-54454050 CCTTACACTCCCCTCCCGCCCGC No data
Right 1041107027 8:54454065-54454087 ATCCTGGACCCACGGGGTACTGG No data
1041107012_1041107035 30 Left 1041107012 8:54454028-54454050 CCTTACACTCCCCTCCCGCCCGC No data
Right 1041107035 8:54454081-54454103 GTACTGGCCCGGGGACAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041107012 Original CRISPR GCGGGCGGGAGGGGAGTGTA AGG (reversed) Intergenic
No off target data available for this crispr