ID: 1041107139

View in Genome Browser
Species Human (GRCh38)
Location 8:54454539-54454561
Sequence CCGTGGGCCCCTGAGTGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041107139_1041107145 15 Left 1041107139 8:54454539-54454561 CCTGGTCACTCAGGGGCCCACGG No data
Right 1041107145 8:54454577-54454599 ATTCCTCCAGGTCAGCCCCACGG No data
1041107139_1041107144 3 Left 1041107139 8:54454539-54454561 CCTGGTCACTCAGGGGCCCACGG No data
Right 1041107144 8:54454565-54454587 AGCGTGGCTCTGATTCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041107139 Original CRISPR CCGTGGGCCCCTGAGTGACC AGG (reversed) Intergenic
No off target data available for this crispr