ID: 1041107869

View in Genome Browser
Species Human (GRCh38)
Location 8:54459230-54459252
Sequence TGAGCCGCAGGCGGCCGCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 173}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041107865_1041107869 -8 Left 1041107865 8:54459215-54459237 CCTGCACGGCCTGGCTGAGCCGC 0: 1
1: 0
2: 0
3: 42
4: 223
Right 1041107869 8:54459230-54459252 TGAGCCGCAGGCGGCCGCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041107869 Original CRISPR TGAGCCGCAGGCGGCCGCGC TGG Exonic
901055530 1:6447258-6447280 TGGGCCGCAGGCGCCAGGGCCGG + Intronic
901332791 1:8423803-8423825 GCAGCCGCCCGCGGCCGCGCCGG - Intronic
901551206 1:9997384-9997406 TCAGGCGAAGGCGGCCGGGCCGG + Intronic
901836348 1:11926297-11926319 TGAGGCGCGGGCGGCCGGGCCGG - Exonic
903573302 1:24322050-24322072 GGAGCCGCAGGCGACCTCCCCGG + Intronic
903829076 1:26164238-26164260 CGAGTCGCAGGAGGCCGAGCCGG - Intergenic
904253000 1:29237862-29237884 TGCGCCCCGGGCGGCCGGGCGGG + Intronic
904619069 1:31764509-31764531 TGGGCCCCAGGCGCCGGCGCGGG + Intronic
905177915 1:36149498-36149520 TGCCCCGCGGGAGGCCGCGCAGG - Intronic
905546497 1:38804297-38804319 TGCGCCGCCGGCAGCAGCGCGGG + Intergenic
906315963 1:44786568-44786590 GGCGCAGCAGGCGGCCCCGCTGG + Exonic
908131860 1:61082428-61082450 GGAGGCGGAGGCGGGCGCGCGGG + Intronic
908544026 1:65147566-65147588 GGAGCCCCGGCCGGCCGCGCGGG - Intronic
914911417 1:151790462-151790484 TGAGTGGGAGGCGGCGGCGCTGG - Intronic
921206998 1:212858016-212858038 TGGGCGGGAGGCGGCCCCGCGGG - Intergenic
922416643 1:225428140-225428162 GGAGCCCCGGGCGGCCTCGCCGG - Intronic
923171411 1:231421345-231421367 TGGGCCGCAGGCCGCCGCCGGGG + Exonic
923490369 1:234478743-234478765 TCCGCAGCTGGCGGCCGCGCTGG - Exonic
1065188786 10:23192650-23192672 TGAGCTGCTGGCGGACGAGCAGG + Exonic
1074182709 10:111077892-111077914 TGAGCCGCAGCCAGGCGAGCGGG + Exonic
1075587127 10:123666238-123666260 GGAGCCTCAGGCGGCCTCCCGGG - Intergenic
1076650101 10:131981737-131981759 TGAGGCGGAGGAGGCGGCGCGGG - Intronic
1076871157 10:133195789-133195811 TCAGCCGCGGACGGCCGCTCCGG - Exonic
1076876529 10:133218990-133219012 TGAGCCTCCTGCGGCCGTGCGGG - Intronic
1077105990 11:842894-842916 CGAGCGGGAGGCGGCGGCGCAGG + Intronic
1078577747 11:12516194-12516216 TGAGCCGCAGGCCGGCTAGCTGG + Intronic
1078631891 11:13010512-13010534 CGAGGCGCAGGCGGCGGCGCTGG + Intergenic
1082283694 11:50298426-50298448 CTGGCCGCAGGCGGCCGGGCGGG - Intergenic
1083164134 11:60873249-60873271 CAAGCCGCAGGGGGCCGGGCTGG - Exonic
1083667995 11:64285704-64285726 TGCGCCGCTGGCGGGCGCCCGGG - Intronic
1083821177 11:65172275-65172297 TGAGCTTCAGGTGGGCGCGCTGG - Exonic
1084008678 11:66336052-66336074 TGAGCAGCAGGCGCTCCCGCAGG + Exonic
1084621000 11:70270463-70270485 TGAGCCACAGGTGGGCGCTCAGG - Intergenic
1084720418 11:70902145-70902167 AGAGCAGCAGGCGGCCACCCGGG + Intronic
1088250719 11:107858837-107858859 GGAGCCCCAGCCGGCCGCACAGG - Exonic
1097107672 12:56634957-56634979 CGGGCCGCAGGCGGCGGCGGCGG + Intronic
1097107678 12:56634984-56635006 AGAGGCGCAGGTGGCCGAGCCGG + Intronic
1102457089 12:113077656-113077678 GGCGGCGCAGGCGGCGGCGCCGG - Exonic
1103563259 12:121803629-121803651 CGGGCCGGAGGCGGGCGCGCGGG - Intergenic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1106340283 13:28820394-28820416 AGAGCCGGCGGCGGCGGCGCAGG - Exonic
1107481529 13:40789634-40789656 TGAGCTGGACGCGGCCACGCCGG + Exonic
1113435471 13:110287673-110287695 TGAGCCCCAGACAGCCGCCCAGG - Intronic
1114459448 14:22877356-22877378 TGGGCAACAGGCGGCCTCGCAGG - Exonic
1114477479 14:23007091-23007113 AGAGGCGGAGGCGGGCGCGCGGG + Intronic
1117722157 14:58638337-58638359 GGAGCGGCAGGAGGCCACGCTGG + Exonic
1120809833 14:88792464-88792486 CGAGCCGCAGGTGGCAGCTCGGG + Exonic
1122558301 14:102592984-102593006 CGAGGCGCAGGCGGCCGAGGCGG - Exonic
1122707282 14:103629226-103629248 AGCGGCGCAGGCGGCCGAGCGGG + Intronic
1123023987 14:105415054-105415076 AGCGCCACGGGCGGCCGCGCGGG + Intronic
1123827889 15:24101599-24101621 GGAACCGGAGGCTGCCGCGCAGG + Intergenic
1123842348 15:24261010-24261032 GGAACCGGAGGCTGCCGCGCAGG + Intergenic
1123862008 15:24477601-24477623 GGAACCGGAGGCTGCCGCGCAGG + Intergenic
1127763787 15:62165328-62165350 TGGGCCGCTGGCGGCTGGGCGGG - Intergenic
1128119093 15:65133034-65133056 GAAGCCGCAGCCGGCGGCGCCGG + Exonic
1128912049 15:71524477-71524499 TAAGCTGCAGGAGGCTGCGCAGG + Intronic
1130669656 15:85900235-85900257 TGAGCCGCAGTCACCCGCGGGGG + Intergenic
1131515395 15:93073296-93073318 GTAGCCGGAGGCGGCCGGGCGGG + Intronic
1132856545 16:2047626-2047648 GGAGCCGCAGGAGGCGGCCCGGG + Exonic
1133916081 16:10111328-10111350 GCAGCGGCAGGCGGCCGCGCGGG + Intronic
1134531985 16:14990220-14990242 TGAGGCACGGGCGGCCGGGCCGG - Intronic
1141724746 16:85780351-85780373 TGCGCCCCATGCTGCCGCGCGGG - Intronic
1142125287 16:88407161-88407183 TGAGCCGCAGCCGCCCACTCAGG - Intergenic
1142494620 17:299705-299727 TGTGCGGCACGGGGCCGCGCCGG + Intronic
1143247912 17:5501172-5501194 CGAGCCGCAGGCAGCGGAGCTGG - Intronic
1145041281 17:19579897-19579919 GGAGCGGCTGGCGGCGGCGCGGG - Intergenic
1145846281 17:28041824-28041846 TGAGGAGAAGGCGGCCGCGGCGG + Intronic
1146747520 17:35345627-35345649 CGAGCAGCAGGCGGCTGCGGAGG - Intergenic
1146912548 17:36658017-36658039 TGAGCCGGAGGCGCCCGCCCTGG + Intergenic
1147393179 17:40122346-40122368 TGAGGCGAAGGCGGCGGCGGCGG + Intronic
1148060086 17:44830180-44830202 TGAGGCGAAGGCGGCAGCGGCGG - Intronic
1148555415 17:48576233-48576255 AGAGGCGGAGGCGGCCGAGCCGG + Exonic
1148556625 17:48582320-48582342 CGAGCCGCCCGCGGACGCGCCGG + Intronic
1151612045 17:75182686-75182708 TGAGCCGCGGCCGGCCCCGTGGG + Intergenic
1151833746 17:76570218-76570240 GGAGCCGCTGGCGGCTGGGCTGG + Intronic
1152556719 17:81056764-81056786 TTAGCCGCAGCCAGCCGCCCTGG + Intronic
1152687190 17:81700510-81700532 TGGGGCGCAGGCGGCCCCCCAGG + Exonic
1152689725 17:81712476-81712498 CGTGCAGCAGGCGGCCCCGCAGG - Exonic
1152747928 17:82049742-82049764 TGTGCAGCAGGCGGGCGCCCAGG + Exonic
1152809589 17:82375299-82375321 GGCCCCGCACGCGGCCGCGCAGG - Exonic
1155429732 18:25742828-25742850 TGAGCAGCAGGCTGCAGCTCAGG + Intergenic
1159040740 18:63320570-63320592 GGAACCGCACGCGGCCGGGCCGG + Intergenic
1159586797 18:70289406-70289428 AGAGCCGTCCGCGGCCGCGCAGG - Intronic
1160037121 18:75311516-75311538 TGAGCAGCAGGCGGTGGGGCTGG - Intergenic
1160859030 19:1229943-1229965 TGAGCTGCATGCGGCCGCCTCGG - Exonic
1161013108 19:1969607-1969629 TGAGACGCAGGCGTTCGGGCCGG - Exonic
1161550395 19:4909440-4909462 GGGGCCGCAGGAGGCCGTGCCGG - Exonic
1161837859 19:6660016-6660038 TGAGCCGGGTGCGGACGCGCCGG + Intergenic
1163503226 19:17688217-17688239 TGGGCCGGAGGCGGCCGGGCCGG + Intronic
1163575785 19:18110147-18110169 TGGGCCGCTGGGGGCCGGGCTGG - Intronic
1163725183 19:18919310-18919332 GGAGCCGCCGGAGGCCGGGCCGG + Exonic
1165140585 19:33697663-33697685 TGAACCACAGGCAGCCGCCCAGG - Intronic
1165906424 19:39197163-39197185 TGAGCCTCGGACGGCTGCGCCGG - Exonic
1166366612 19:42281234-42281256 GGAGCCGCAGGCGGCCGGCAGGG + Intronic
1168257594 19:55175177-55175199 GGAGCTGCAGGCGGCTCCGCGGG - Exonic
1168272638 19:55258488-55258510 GGAGCCGCCGGCGGCGGGGCGGG - Exonic
925378781 2:3408949-3408971 TGTGCCGCAGCGGGCCGCGCAGG - Intronic
927156485 2:20224272-20224294 GGAGCGGGAGGCGGCCGCGTTGG - Intronic
929460932 2:42101622-42101644 TGGGCCGGGGGCGGCCACGCGGG - Intergenic
932699846 2:73985053-73985075 GGAGCCCCAGGCGGCGGCGGCGG + Intergenic
938408255 2:131044597-131044619 TGACCGGCAGGCGGCCAGGCAGG - Intronic
942009916 2:171751219-171751241 TGAGCGGCAGGCAGGCGGGCGGG - Intergenic
948463396 2:238140892-238140914 TGAGCGCCAGGAGGCCGCGGTGG - Exonic
948805673 2:240452698-240452720 GAAACCGCAGGCGGCCGCCCCGG - Intronic
1173704201 20:45098147-45098169 TCAGCCAGAGGCGGCGGCGCAGG + Exonic
1175184891 20:57173439-57173461 TGAGCAGCAGGGGGCCCAGCAGG + Intronic
1176194646 20:63831470-63831492 GGGGTCGCAGGGGGCCGCGCCGG + Intergenic
1180008591 21:45034859-45034881 TGAGCCACAGGAGGCCGGGGTGG + Intergenic
1180151578 21:45950845-45950867 AGAGCCGGAGGCGGCCGCTGCGG - Intergenic
1181077978 22:20394149-20394171 AGAGCAGCAGGCGGCCGCTGCGG - Exonic
1182801963 22:33038873-33038895 TGAGCTGCAGGCGGAAGCCCCGG + Intronic
1184216211 22:43069012-43069034 TGAGCCACAGGCTGCCACGAGGG - Intronic
949893643 3:8752940-8752962 TGAGCCTCAGGCTGCAGCCCTGG + Exonic
953910169 3:46888844-46888866 TGCCCCGAAGGCGGCCACGCTGG + Intronic
954194767 3:48990098-48990120 GGAGCCGCCTGCGTCCGCGCCGG - Exonic
955325797 3:58008693-58008715 TGAGCCGCAGCCCGTCGCTCAGG - Exonic
961665906 3:128492968-128492990 TGCGCGGCAGGCGGGCTCGCGGG + Exonic
964819597 3:160755632-160755654 TGAGCCGCAGGCGGCCGGCTGGG - Intronic
967904073 3:194486705-194486727 TGAGCCGCAGCGCGCGGCGCCGG - Intronic
968187006 3:196639846-196639868 GCAGGCGCAGGCGGCTGCGCGGG - Exonic
969858607 4:10019023-10019045 GGAGCCGAAGGCGCCCGCGAGGG + Exonic
973613701 4:52659369-52659391 TGGGCCGCGGCCGGCGGCGCGGG + Intergenic
979231536 4:118353020-118353042 TGAGCCCCAGGTAGCGGCGCAGG + Intergenic
981550605 4:145937750-145937772 CGAGCCGCCGGCGGCAGCGGCGG - Intronic
982679080 4:158408158-158408180 TGAGCTGCCGGCCGCCCCGCTGG + Intronic
985512083 5:318696-318718 AGAGCCGCAGGCGCCTGTGCGGG + Intronic
985574261 5:666234-666256 TCACCCACAGGCGGCCGCCCTGG + Intronic
985822951 5:2172718-2172740 TGACCCAGAGGCGGCCGGGCAGG + Intergenic
990148386 5:52788318-52788340 TCAGCGCCAGGGGGCCGCGCTGG - Exonic
990165553 5:52989572-52989594 CGAGCCCCAGGAAGCCGCGCGGG - Intronic
992249842 5:74866105-74866127 TGAGGCCGAGACGGCCGCGCCGG - Intronic
993654374 5:90559062-90559084 TTACCCGCAGGCCGCGGCGCCGG - Intronic
994648513 5:102498766-102498788 AGAGCCGCTGGAGGCCGCGCGGG - Exonic
997265006 5:132490365-132490387 CGAGCCGCGGGCCGCGGCGCGGG - Intronic
997304044 5:132825593-132825615 TGAGTCGCCGGGGGCCGCGCTGG + Exonic
997304054 5:132825621-132825643 TGGGCCGCAGACGGGCGGGCAGG + Exonic
998018909 5:138753599-138753621 CGAGCCGCGGGCGGGCGAGCGGG + Intronic
998200554 5:140114667-140114689 TGCGCAGGAAGCGGCCGCGCTGG - Exonic
1001563798 5:172686829-172686851 TGAGCCGCAGGCCGCAGCTGTGG - Exonic
1001639508 5:173234891-173234913 TGGGCCCGAGGCGGCTGCGCCGG - Exonic
1004229019 6:13814369-13814391 GAAGCCGCTGGCGGCCGGGCAGG + Exonic
1006637190 6:35469097-35469119 TGAGCCGGAGGCGGGCACGTCGG + Intronic
1007368220 6:41409224-41409246 AGAGGCGAAGGCGGCTGCGCGGG - Intergenic
1007785293 6:44276272-44276294 TGCGCCACAGGCAGCTGCGCCGG - Exonic
1010277907 6:73990703-73990725 TGTGGAGCAGGAGGCCGCGCTGG + Intergenic
1013615001 6:111834705-111834727 GGAGCTGCAGGCGGCAGTGCTGG + Intronic
1015965432 6:138692560-138692582 CGAGGGCCAGGCGGCCGCGCTGG - Intronic
1016329846 6:142945052-142945074 CGCGGCGCAGGCGGCCGGGCGGG - Intronic
1016923329 6:149317425-149317447 GGAGCAGCAGGCGGCGGCGGCGG - Intronic
1019308230 7:346557-346579 TGAGCCCCGGGCGGCTGCGGTGG - Intergenic
1019308240 7:346591-346613 TGAGCCCCGGGCGGCGGCGGTGG - Intergenic
1019308260 7:346659-346681 TGAGCCCCGGGCGGCGGCGGTGG - Intergenic
1019308279 7:346726-346748 TGAGCCCCGGGCGGCGGCGGTGG - Intergenic
1020056521 7:5121339-5121361 TGACCCACAGGCGGACTCGCGGG - Intergenic
1020171380 7:5847634-5847656 TGACCCACAGGCGGACTCGCGGG + Intergenic
1020204545 7:6104906-6104928 TGACCCGGAGGCGGCGGCGGCGG + Exonic
1022283487 7:28933549-28933571 TGAGCCTCAGGCTGCCGGGGAGG + Intergenic
1022375281 7:29806603-29806625 GGAGCCGGAGGCGGCGGCGGCGG + Exonic
1022447038 7:30478968-30478990 TGAGCCCCTGGCCACCGCGCAGG + Intergenic
1023955642 7:44884913-44884935 TGCGCAGGAAGCGGCCGCGCTGG + Exonic
1032020690 7:128405898-128405920 GCAGCGGCGGGCGGCCGCGCGGG - Intronic
1032215259 7:129952618-129952640 TGAGGAGCCCGCGGCCGCGCCGG + Exonic
1033406371 7:141074019-141074041 GGGGCGGGAGGCGGCCGCGCTGG + Intergenic
1035733460 8:1869914-1869936 TGGGCCGCAGGAGGCAGAGCGGG + Intronic
1041107869 8:54459230-54459252 TGAGCCGCAGGCGGCCGCGCTGG + Exonic
1043502658 8:80873386-80873408 GGCGGCGCGGGCGGCCGCGCGGG - Intronic
1045583432 8:103501590-103501612 CGAGCAGCGGGCGGCGGCGCGGG + Intronic
1049451638 8:142665128-142665150 TCACCCGCAGGAGGCCGAGCTGG - Exonic
1049719567 8:144109414-144109436 GGACCTGCAGGCGGCGGCGCAGG + Exonic
1050305165 9:4299276-4299298 TGAGCCGGTGGCGTTCGCGCGGG - Intronic
1050455733 9:5832641-5832663 GGAGCCGCAAACGGACGCGCGGG + Intronic
1057785981 9:98087646-98087668 GGGGCCGCAGGCGGCTGCGCTGG + Exonic
1060109245 9:120894717-120894739 GGAGCCGCGGGCGGCCGGGTGGG - Intronic
1060881883 9:127123093-127123115 TGAGCCCCAGGCTGGCGGGCGGG + Intronic
1061208550 9:129177780-129177802 CGGGCCGAAGTCGGCCGCGCTGG + Exonic
1062488814 9:136794406-136794428 TGAGCCGCTGGGCACCGCGCCGG + Intronic
1062499671 9:136846983-136847005 CGCGCCGGGGGCGGCCGCGCGGG - Exonic
1062565676 9:137163005-137163027 TGAGGCGCGGGCGGCCACCCTGG + Intronic
1062665020 9:137665844-137665866 AGAGCTGCACGCGGCCGCCCAGG - Intronic
1203776152 EBV:74314-74336 TGAGCGGCGTGAGGCCGCGCAGG + Intergenic
1189659317 X:43279685-43279707 GCAGCGGCTGGCGGCCGCGCGGG - Intergenic
1189915563 X:45851788-45851810 TTAGCCGCGGGCGGCCGCCGCGG - Intergenic
1199760223 X:150899024-150899046 GGAGCGGGAGGCGGCAGCGCCGG + Intergenic
1200061540 X:153486034-153486056 TGAGGCCCAGGAGGCCGCGTGGG - Exonic