ID: 1041108404

View in Genome Browser
Species Human (GRCh38)
Location 8:54463474-54463496
Sequence AACTTGAGCCTACTCCAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041108404_1041108414 20 Left 1041108404 8:54463474-54463496 CCCATCTGGAGTAGGCTCAAGTT No data
Right 1041108414 8:54463517-54463539 AATGGAGAGAGTATTTCTTTAGG No data
1041108404_1041108415 28 Left 1041108404 8:54463474-54463496 CCCATCTGGAGTAGGCTCAAGTT No data
Right 1041108415 8:54463525-54463547 GAGTATTTCTTTAGGTCCTCTGG No data
1041108404_1041108408 -9 Left 1041108404 8:54463474-54463496 CCCATCTGGAGTAGGCTCAAGTT No data
Right 1041108408 8:54463488-54463510 GCTCAAGTTCCTCCACAGGGTGG No data
1041108404_1041108411 2 Left 1041108404 8:54463474-54463496 CCCATCTGGAGTAGGCTCAAGTT No data
Right 1041108411 8:54463499-54463521 TCCACAGGGTGGGCTCCTAATGG No data
1041108404_1041108409 -8 Left 1041108404 8:54463474-54463496 CCCATCTGGAGTAGGCTCAAGTT No data
Right 1041108409 8:54463489-54463511 CTCAAGTTCCTCCACAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041108404 Original CRISPR AACTTGAGCCTACTCCAGAT GGG (reversed) Intergenic
No off target data available for this crispr