ID: 1041108710

View in Genome Browser
Species Human (GRCh38)
Location 8:54466435-54466457
Sequence AGCGCCTCAGACGCCCGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 55}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041108710_1041108715 10 Complete closest: 107
total_pairs: 2
max_distance: 1000
Left 1041108710 8:54466435-54466457 CCTGCGCGGGCGTCTGAGGCGCT 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1041108715 8:54466468-54466490 GGAGCGCGCTCCCCTCGCCAGGG 0: 1
1: 0
2: 0
3: 25
4: 480
1041108710_1041108714 9 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1041108710 8:54466435-54466457 CCTGCGCGGGCGTCTGAGGCGCT 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1041108714 8:54466467-54466489 CGGAGCGCGCTCCCCTCGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041108710 Original CRISPR AGCGCCTCAGACGCCCGCGC AGG (reversed) Intergenic
900116991 1:1033181-1033203 GGCGCCCCCGACTCCCGCGCGGG - Intronic
900142848 1:1145745-1145767 TGAGCCTCAGACGCCCTGGCAGG - Intergenic
905346268 1:37313130-37313152 AGCTCCTCAGACCCCCACCCAGG + Intergenic
912879137 1:113390982-113391004 GGCGCCCCGGCCGCCCGCGCGGG + Exonic
1062908624 10:1197471-1197493 AGGGCTTCAGACGCCCCAGCTGG + Intronic
1066647196 10:37622011-37622033 AGGGCCTCAGAAGCCCTCGGTGG + Intergenic
1079043294 11:17078279-17078301 AGCGCCCCAGAGCCCTGCGCAGG - Intronic
1080034849 11:27700352-27700374 AGCGCCTCGGGCTCCCGGGCCGG - Intronic
1081993045 11:47347803-47347825 AGGGCCTCAGACTCCAGCACTGG + Intronic
1083129919 11:60615684-60615706 CGCGCCTCAGGTGTCCGCGCGGG + Intergenic
1083619804 11:64043271-64043293 AGCTCCTCAGAGCCCCGAGCAGG - Intronic
1087014666 11:93543375-93543397 CGCGCCAGAGTCGCCCGCGCGGG - Exonic
1087766801 11:102164147-102164169 CGCGCCTCAGCCTCCCGAGCTGG + Intronic
1096116811 12:49059961-49059983 AGCGCCCCGGCCGCCCGCGCCGG + Intergenic
1103509953 12:121467358-121467380 CGCGCCTCGCACGCCCGCGCTGG + Intronic
1112759910 13:102683260-102683282 AGCTCCTCAGAAGGCCGAGCAGG - Intergenic
1114674197 14:24430099-24430121 ACCGCCTCCGCCGCCCGCGCCGG - Intronic
1123023987 14:105415054-105415076 AGCGCCACGGGCGGCCGCGCGGG + Intronic
1128082341 15:64864143-64864165 AGAGCCTCAGAGGCCCCAGCAGG - Intronic
1129780174 15:78264705-78264727 AGCGCCCCGGACGCCCCTGCCGG - Intronic
1138597775 16:58038326-58038348 AGCGCTTCCGACGCCGCCGCAGG - Exonic
1141820056 16:86439544-86439566 AGCGCCTGAGACCCCCACGCTGG + Intergenic
1143446817 17:7014758-7014780 AGCGGCTCGGGCCCCCGCGCAGG - Exonic
1146461171 17:33047031-33047053 AGCGCCTGAGATGGCCTCGCAGG + Intronic
1152729161 17:81961376-81961398 AGCGCCTCCGGCGGCCGCGGCGG - Intronic
1161610155 19:5237899-5237921 AGCGGCTCAGATGCCCCGGCTGG + Intronic
1161706670 19:5825339-5825361 CACGCCTCAGATGCCCGCGCAGG - Intronic
1163291226 19:16380685-16380707 AGAGCCTCAGACGACCGCATCGG - Intronic
1164692638 19:30222599-30222621 AGCCCCGCAGACGGCCGGGCAGG - Intergenic
1165435100 19:35791028-35791050 GGCGCCTCCTACGCCAGCGCTGG - Intergenic
1166694990 19:44847091-44847113 CGGGCCTCAGACGCCCAAGCCGG - Intronic
1166983874 19:46648657-46648679 AGCGACTCAGACGGCAGCGGTGG - Exonic
932780453 2:74555672-74555694 GACGCCTCAGAAGCCCGGGCAGG + Intronic
946829235 2:223711203-223711225 AGGGCCTCAGACACCCAGGCTGG - Intergenic
947581918 2:231325532-231325554 AGAGCCTCAGAGGCCCCAGCTGG - Intronic
1172583422 20:36065673-36065695 ACCACCTCAGAAGCCCTCGCTGG - Intergenic
1176014928 20:62926195-62926217 CGGGCCTCAGACGCCGGCCCTGG - Intronic
1176065522 20:63192446-63192468 AGCGCCTCAGCCGGGCGCGGTGG - Intergenic
1180215015 21:46318274-46318296 AGTGCCCCAGAAGCCAGCGCTGG + Intronic
1181583795 22:23842136-23842158 AGGGCCTCTGACGCCTGGGCGGG + Intergenic
1183526830 22:38328040-38328062 AGGGCCTCAGAGGTCTGCGCCGG + Intronic
954933894 3:54309112-54309134 AGAGCCTCAGATGCCCATGCAGG + Intronic
968230804 3:197003499-197003521 GCCGCCTCAGGCGCCCGCTCTGG + Intronic
968640604 4:1712598-1712620 AGCGTCGCAGAGGCCCGCGGCGG - Intergenic
976184352 4:82430002-82430024 GCCGCCTCAGTCGCCAGCGCCGG - Exonic
981782855 4:148445472-148445494 GGCGGCTCAGACGCCCGCGGAGG + Intergenic
982745744 4:159103197-159103219 CGGCCCTCGGACGCCCGCGCCGG + Intergenic
983945850 4:173584692-173584714 AGCGCCTCATACACCCGTTCTGG + Intergenic
1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG + Intergenic
1002926695 6:1609453-1609475 AGCCCCGCCGACGCCAGCGCTGG - Intergenic
1019334656 7:477236-477258 AGCCCCTGAGACGCGCGCCCAGG - Intergenic
1028899140 7:96076204-96076226 GGCGGCTCAGGCGCCCGGGCCGG + Intronic
1041108710 8:54466435-54466457 AGCGCCTCAGACGCCCGCGCAGG - Intergenic
1046905626 8:119569370-119569392 AGTGCCTCTGACTCCCGTGCAGG - Exonic
1048175621 8:132149674-132149696 AGGGCCACAGACACGCGCGCGGG + Intronic
1058885856 9:109320738-109320760 AGCCCCTCGGCAGCCCGCGCAGG - Exonic
1060116161 9:120942644-120942666 AGCGTCTCAAAGGCCCACGCAGG + Intergenic
1061038775 9:128127898-128127920 AGAGCCGCAGAGGCCCGCTCGGG + Exonic
1062046152 9:134425489-134425511 AGGCCCTCAGACGACCCCGCTGG - Intronic
1186669835 X:11757855-11757877 GGCGCCTCCCACGCCCGGGCCGG + Intergenic
1189256200 X:39641616-39641638 AGTGCCTCTGACACCCGCCCAGG + Intergenic
1189322423 X:40094961-40094983 AGCGCCTCAAAGGACAGCGCTGG + Intronic