ID: 1041108710

View in Genome Browser
Species Human (GRCh38)
Location 8:54466435-54466457
Sequence AGCGCCTCAGACGCCCGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 55}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041108710_1041108714 9 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1041108710 8:54466435-54466457 CCTGCGCGGGCGTCTGAGGCGCT 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1041108714 8:54466467-54466489 CGGAGCGCGCTCCCCTCGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 101
1041108710_1041108715 10 Complete closest: 107
total_pairs: 2
max_distance: 1000
Left 1041108710 8:54466435-54466457 CCTGCGCGGGCGTCTGAGGCGCT 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1041108715 8:54466468-54466490 GGAGCGCGCTCCCCTCGCCAGGG 0: 1
1: 0
2: 0
3: 25
4: 480

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041108710 Original CRISPR AGCGCCTCAGACGCCCGCGC AGG (reversed) Intergenic