ID: 1041108715

View in Genome Browser
Species Human (GRCh38)
Location 8:54466468-54466490
Sequence GGAGCGCGCTCCCCTCGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 506
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 480}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041108710_1041108715 10 Complete closest: 107
total_pairs: 2
max_distance: 1000
Left 1041108710 8:54466435-54466457 CCTGCGCGGGCGTCTGAGGCGCT 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1041108715 8:54466468-54466490 GGAGCGCGCTCCCCTCGCCAGGG 0: 1
1: 0
2: 0
3: 25
4: 480
1041108709_1041108715 13 Too many individual off targets Left 1041108709 8:54466432-54466454 CCTCCTGCGCGGGCGTCTGAGGC 0: 1
1: 0
2: 4
3: 113
4: 6036
Right 1041108715 8:54466468-54466490 GGAGCGCGCTCCCCTCGCCAGGG 0: 1
1: 0
2: 0
3: 25
4: 480

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041108715 Original CRISPR GGAGCGCGCTCCCCTCGCCA GGG Intergenic