ID: 1041108855

View in Genome Browser
Species Human (GRCh38)
Location 8:54467146-54467168
Sequence GGACGCGGAGGAAAAGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2348
Summary {0: 1, 1: 0, 2: 5, 3: 200, 4: 2142}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041108855_1041108868 5 Too many individual off targets Left 1041108855 8:54467146-54467168 CCACCTTCTTTTCCTCCGCGTCC 0: 1
1: 0
2: 5
3: 200
4: 2142
Right 1041108868 8:54467174-54467196 AGGGTTTCGGCGCGCGGGGCAGG 0: 1
1: 0
2: 2
3: 9
4: 130
1041108855_1041108870 25 Too many individual off targets Left 1041108855 8:54467146-54467168 CCACCTTCTTTTCCTCCGCGTCC 0: 1
1: 0
2: 5
3: 200
4: 2142
Right 1041108870 8:54467194-54467216 AGGCCTGGAGCGCCGTGAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 154
1041108855_1041108869 10 Too many individual off targets Left 1041108855 8:54467146-54467168 CCACCTTCTTTTCCTCCGCGTCC 0: 1
1: 0
2: 5
3: 200
4: 2142
Right 1041108869 8:54467179-54467201 TTCGGCGCGCGGGGCAGGCCTGG 0: 1
1: 0
2: 2
3: 10
4: 145
1041108855_1041108865 -1 Too many individual off targets Left 1041108855 8:54467146-54467168 CCACCTTCTTTTCCTCCGCGTCC 0: 1
1: 0
2: 5
3: 200
4: 2142
Right 1041108865 8:54467168-54467190 CGGCGGAGGGTTTCGGCGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 55
1041108855_1041108863 -8 Too many individual off targets Left 1041108855 8:54467146-54467168 CCACCTTCTTTTCCTCCGCGTCC 0: 1
1: 0
2: 5
3: 200
4: 2142
Right 1041108863 8:54467161-54467183 CCGCGTCCGGCGGAGGGTTTCGG 0: 1
1: 0
2: 1
3: 1
4: 28
1041108855_1041108866 0 Too many individual off targets Left 1041108855 8:54467146-54467168 CCACCTTCTTTTCCTCCGCGTCC 0: 1
1: 0
2: 5
3: 200
4: 2142
Right 1041108866 8:54467169-54467191 GGCGGAGGGTTTCGGCGCGCGGG 0: 1
1: 0
2: 1
3: 9
4: 60
1041108855_1041108867 1 Too many individual off targets Left 1041108855 8:54467146-54467168 CCACCTTCTTTTCCTCCGCGTCC 0: 1
1: 0
2: 5
3: 200
4: 2142
Right 1041108867 8:54467170-54467192 GCGGAGGGTTTCGGCGCGCGGGG 0: 1
1: 0
2: 2
3: 5
4: 56
1041108855_1041108872 29 Left 1041108855 8:54467146-54467168 CCACCTTCTTTTCCTCCGCGTCC 0: 1
1: 0
2: 5
3: 200
4: 2142
Right 1041108872 8:54467198-54467220 CTGGAGCGCCGTGAGCAGGCCGG 0: 1
1: 0
2: 1
3: 13
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041108855 Original CRISPR GGACGCGGAGGAAAAGAAGG TGG (reversed) Intergenic