ID: 1041109396

View in Genome Browser
Species Human (GRCh38)
Location 8:54470485-54470507
Sequence CCGCGCGCGCCGCCCGCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041109396_1041109399 2 Left 1041109396 8:54470485-54470507 CCCTTGGCGGGCGGCGCGCGCGG No data
Right 1041109399 8:54470510-54470532 TCCAGATGCAGCCGCCGCGCCGG No data
1041109396_1041109401 3 Left 1041109396 8:54470485-54470507 CCCTTGGCGGGCGGCGCGCGCGG No data
Right 1041109401 8:54470511-54470533 CCAGATGCAGCCGCCGCGCCGGG No data
1041109396_1041109402 4 Left 1041109396 8:54470485-54470507 CCCTTGGCGGGCGGCGCGCGCGG No data
Right 1041109402 8:54470512-54470534 CAGATGCAGCCGCCGCGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041109396 Original CRISPR CCGCGCGCGCCGCCCGCCAA GGG (reversed) Intergenic
No off target data available for this crispr