ID: 1041109790

View in Genome Browser
Species Human (GRCh38)
Location 8:54473469-54473491
Sequence AATGTGCATGCAGATCTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041109789_1041109790 -1 Left 1041109789 8:54473447-54473469 CCAGAACAGTACTTCTCAAATGA No data
Right 1041109790 8:54473469-54473491 AATGTGCATGCAGATCTCCTTGG No data
1041109787_1041109790 28 Left 1041109787 8:54473418-54473440 CCATCGCTGCACTTCTTCTTTAG No data
Right 1041109790 8:54473469-54473491 AATGTGCATGCAGATCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041109790 Original CRISPR AATGTGCATGCAGATCTCCT TGG Intergenic
No off target data available for this crispr