ID: 1041110700

View in Genome Browser
Species Human (GRCh38)
Location 8:54479876-54479898
Sequence CAGTGTAGTGGGGAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 711
Summary {0: 1, 1: 0, 2: 2, 3: 65, 4: 643}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041110689_1041110700 30 Left 1041110689 8:54479823-54479845 CCACCATGGGTAGCATACACAAG 0: 1
1: 1
2: 1
3: 7
4: 92
Right 1041110700 8:54479876-54479898 CAGTGTAGTGGGGAGGTGGAAGG 0: 1
1: 0
2: 2
3: 65
4: 643
1041110690_1041110700 27 Left 1041110690 8:54479826-54479848 CCATGGGTAGCATACACAAGTGT 0: 1
1: 0
2: 0
3: 10
4: 92
Right 1041110700 8:54479876-54479898 CAGTGTAGTGGGGAGGTGGAAGG 0: 1
1: 0
2: 2
3: 65
4: 643

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041110700 Original CRISPR CAGTGTAGTGGGGAGGTGGA AGG Intergenic
900365795 1:2311485-2311507 CAGTGCAGTGGGGAGGAGTTGGG + Intergenic
900768404 1:4520765-4520787 CCGTGTATGGTGGAGGTGGAGGG - Intergenic
901434506 1:9238475-9238497 CACTGGAGTGGAGTGGTGGAAGG + Intronic
901644494 1:10709265-10709287 CAGTGGAGTGCGGGGGCGGATGG - Intronic
901873369 1:12151722-12151744 CAGTGAAGTGGGGCAGTGGCGGG + Intergenic
901882907 1:12204436-12204458 TAGGGTAGCCGGGAGGTGGATGG - Intronic
902234222 1:15047430-15047452 ACGTGCAGTGGGGAGGTGGAGGG + Intronic
902293643 1:15451403-15451425 GGGTGTAGTGGGGAGGGAGAAGG + Intergenic
902509980 1:16961150-16961172 CAGGGAAGGGGGGAGGTGGGCGG + Intronic
902586367 1:17440843-17440865 AAGTGGGGTGGAGAGGTGGAGGG - Intergenic
902602500 1:17549868-17549890 CAGTGCTGTGGGGTGATGGATGG + Intronic
902920393 1:19663185-19663207 CAGTGTGGTGGCAAGGAGGAAGG + Intergenic
903265151 1:22153741-22153763 ATGTGTGTTGGGGAGGTGGATGG + Intergenic
904119034 1:28184009-28184031 CAATCCAGCGGGGAGGTGGAGGG - Intronic
905029231 1:34870433-34870455 GAGTCTCTTGGGGAGGTGGAGGG - Intronic
905228108 1:36493025-36493047 CACTGGGGTGGGCAGGTGGAAGG + Intergenic
905375562 1:37518162-37518184 CAGTGCAGTGGGGGGCTGAAGGG - Intergenic
905552580 1:38855195-38855217 CAGTCCAGGGGGGAGGTGGAAGG + Intronic
905852781 1:41286546-41286568 CAGTGGGGTGGGGAGGAGAAAGG + Intergenic
905884577 1:41484824-41484846 CAGTGAAGGGGGGAGGGAGATGG + Intergenic
906076541 1:43056154-43056176 CAGTGGTGAGGGGAGATGGATGG + Intergenic
906210964 1:44011917-44011939 CACTGTGGGAGGGAGGTGGAAGG - Intronic
906426573 1:45718854-45718876 TAGTGTAGTGGGGGTGGGGAGGG + Intronic
906789122 1:48643329-48643351 CAGCTAAGTGGGTAGGTGGAGGG - Intronic
907656160 1:56343421-56343443 CAGTGTACTGAGGAGGGGGCTGG - Intergenic
907941775 1:59095338-59095360 CAGTGGATTGGGCAGTTGGAAGG + Intergenic
909150504 1:71996958-71996980 AATTATAGTAGGGAGGTGGAGGG - Intronic
909508145 1:76418367-76418389 CAGTGTAGCTTGAAGGTGGAGGG + Intronic
909602528 1:77475286-77475308 CAGGGAGGTGGGGAGGTAGAAGG + Intronic
909904634 1:81179061-81179083 CAGTGCAGTGGGGGGCTGAAGGG + Intergenic
910819734 1:91333455-91333477 AAGGGTAGTGGGAGGGTGGAGGG + Intronic
911103470 1:94111781-94111803 CGGTGTAGTGGGGAGACAGACGG + Intronic
911293459 1:96084814-96084836 CAGAGTATTGGAGATGTGGAGGG - Intergenic
911574766 1:99562323-99562345 GAGTGGAGTGGGGAGAGGGAGGG + Intergenic
911954561 1:104217894-104217916 CAGTGCAGTGGGGGGGCTGAAGG + Intergenic
912139945 1:106712260-106712282 CAGTGATTGGGGGAGGTGGAGGG + Intergenic
912312949 1:108641310-108641332 CAGTGCAGTGGGGGGGCTGAAGG + Intronic
912540865 1:110414250-110414272 CAGTGTCGTGGGGAAGTTAATGG - Intergenic
912660597 1:111526173-111526195 GTGTGTGGTGGGGAGGTAGAGGG - Intronic
913555075 1:119957907-119957929 CAGTGTAGTGGGAATGAGCATGG + Intronic
913692181 1:121289554-121289576 CAGTGCAGGGGGGAGGCTGAAGG + Intronic
913971417 1:143420824-143420846 CAGAGTATTGAGGAGGTGGAGGG + Intergenic
914065794 1:144246437-144246459 CAGAGTATTGAGGAGGTGGAGGG + Intergenic
914113357 1:144719917-144719939 CAGAGTATTGAGGAGGTGGAGGG - Intergenic
914145374 1:144990560-144990582 CAGTGCAGGGGGGAGGCTGAAGG - Intronic
915076193 1:153309684-153309706 CAGAGGACTGGGGAGGGGGAGGG + Intronic
915297373 1:154930689-154930711 CAGGGTGGTGGGGTGGTGGTGGG - Intronic
915562723 1:156696806-156696828 ATGTGTAGAGGGGAGGTGAAAGG - Intergenic
915658047 1:157377744-157377766 TAGTCTGGTGGGGAGGTAGATGG + Intergenic
916718556 1:167465201-167465223 CAGGGTGGTGGGGAGGGGGCTGG - Intronic
916900297 1:169215109-169215131 CAGTGGAAAGGGGAGCTGGAGGG + Intronic
917127436 1:171699758-171699780 CAGTTTAGTGTGTGGGTGGAGGG + Intergenic
917446427 1:175108907-175108929 CAGTGTAGTGGTGGGCTGAAGGG + Intronic
917460471 1:175224901-175224923 GAATAAAGTGGGGAGGTGGATGG + Intergenic
918069359 1:181123576-181123598 CAGTATAGTGGTTAGGTGCATGG - Intergenic
918082960 1:181221576-181221598 CAGTGTCTGGGGGAGGCGGAGGG + Intergenic
919194927 1:194272149-194272171 GACTGTGGTGGGGAGGTGGGGGG - Intergenic
919261714 1:195204429-195204451 CAGTTTAATGGGGTGGAGGAAGG + Intergenic
920097429 1:203495758-203495780 CACTCAAGTGGGGCGGTGGAGGG + Intronic
920173549 1:204086229-204086251 CAGTGAACTGAGGAGGGGGAGGG - Intronic
920667192 1:207971738-207971760 CACTGAAGTGGGGAGGGGGTGGG - Intergenic
920883216 1:209899250-209899272 CAGTGCAGTGGGGGGGCTGAAGG + Intergenic
921826594 1:219678966-219678988 CAGGGCAGTGGGGTGGGGGATGG + Intergenic
922060802 1:222089401-222089423 CAGTGGAGTGAGGAGGCTGAGGG + Intergenic
922339650 1:224645218-224645240 CAGGGCAGTGGGGAGGTGGTGGG - Intronic
922392586 1:225161157-225161179 CAGGGTAGTGGGGGAGTGGGAGG - Intronic
922810949 1:228415316-228415338 CAGTGGAGAGGAGAGGCGGAGGG - Exonic
922930099 1:229382180-229382202 CAGTGGAGTGGGCGGCTGGAGGG + Intergenic
923144442 1:231188096-231188118 CAGTGTGATGGAGGGGTGGAAGG - Intronic
923173284 1:231437435-231437457 AAGTGTAGAGGGGAGGTGGGTGG + Intergenic
923265420 1:232309036-232309058 CAGTGTGGTGGGAAAGGGGAGGG - Intergenic
923324878 1:232871893-232871915 CAGTGCAGTGGGGGGGCTGAAGG + Intergenic
923546538 1:234927568-234927590 CAGAGTAGAGGTGAGGTGGAGGG - Intergenic
923729910 1:236540175-236540197 CAGTGTTGTGGGGAGCTCGCAGG + Intronic
924044193 1:240011152-240011174 CAGTCTGGAGGGGAGGAGGAGGG - Intergenic
924313797 1:242774652-242774674 CAGTGCAGTGGTGAGCTGAAGGG + Intergenic
924588597 1:245381662-245381684 CAGAGTATTCTGGAGGTGGATGG - Intronic
1062823841 10:554610-554632 CAGGGCAGTGGGGAGGAGAAGGG - Intronic
1063170192 10:3502673-3502695 CCCTGTAGTGGGGGCGTGGATGG - Intergenic
1063353119 10:5374229-5374251 CAGCGGGGTGGGGAGGGGGAGGG + Exonic
1063521612 10:6746640-6746662 CAGTGTAGTGGGGAGAAAGGGGG - Intergenic
1064648859 10:17487836-17487858 GAGTGTTGTGGGGTGGTGGTGGG + Intergenic
1065828009 10:29589351-29589373 CAGTGTGGTGGGAATCTGGAGGG + Intronic
1066009108 10:31177290-31177312 CAGTGAAGGGAGAAGGTGGAGGG - Intergenic
1066093511 10:32050188-32050210 CTTTGAAGTGGGGATGTGGAGGG - Intronic
1066186232 10:33013202-33013224 CAGTGCAGTGGGGGGCTGAAGGG - Intergenic
1066233977 10:33467944-33467966 CAGTGCAGTGGGGGGCTGAAGGG - Intergenic
1066395788 10:35020265-35020287 CTGAGAAGTGGGGAGGTGGAAGG + Intronic
1067061739 10:43081260-43081282 CAGAGGAGTGGGGAGATAGAGGG - Intronic
1068044365 10:51867404-51867426 CAGTGTAGAGAAGAGATGGAAGG + Intronic
1068394328 10:56442225-56442247 GACTGTTGTGGGGTGGTGGAGGG - Intergenic
1068685952 10:59870024-59870046 TAGTGTAATGGGGTGGTGAATGG - Intronic
1069412522 10:68168228-68168250 GAGTGTACTGGGGAGGGGGCAGG - Intronic
1069821884 10:71233525-71233547 CCGTGGAGTGGGGAGGCAGAGGG - Intronic
1069860007 10:71464645-71464667 CAGGGTGGTGGGGAGGGGGCTGG + Intronic
1069873423 10:71547112-71547134 CAGTCTAGTGGGGAGTCAGATGG + Intronic
1070963658 10:80516489-80516511 AAGTGTATTGGGGAGGAGAATGG + Intronic
1072236673 10:93459878-93459900 CAGGGTAGTGGTAAGGTAGAGGG - Intronic
1072466605 10:95669123-95669145 CAGAGTAGTGGGGGGGTAGGAGG + Intronic
1073177466 10:101565207-101565229 GAGTGTATGGGGGAGGTGGGAGG - Intergenic
1073199653 10:101724997-101725019 CTGTGCACTGGGGAGGAGGAGGG - Intergenic
1073561296 10:104499041-104499063 CAGTGTAGGGGGGTGGGGTAGGG - Intergenic
1073843806 10:107528968-107528990 GACTGTGGTGGGGAGGGGGAGGG + Intergenic
1074425182 10:113344421-113344443 AAGGGTAGTGGGGAGGTGGGTGG + Intergenic
1074902721 10:117833034-117833056 GACTGTGGTGGGGAGGGGGAGGG - Intergenic
1076050618 10:127330303-127330325 TAGTGTAGTGGGGAAATGGCTGG + Intronic
1076450256 10:130552190-130552212 CTGTGGGCTGGGGAGGTGGAGGG + Intergenic
1076754538 10:132562372-132562394 CAGTGTTGTCAGGAGGTGGGAGG + Intronic
1077308465 11:1878203-1878225 CAGAGTGTTGAGGAGGTGGAGGG - Intronic
1077412620 11:2410659-2410681 CAGTGCAGTGGGGAGGGGGCGGG - Intronic
1077613490 11:3659500-3659522 CAGTGGAGGGGAGAGCTGGATGG + Intronic
1078743758 11:14091777-14091799 CAGTGCAGTGGGGGGCTGAAGGG + Intronic
1078912684 11:15747658-15747680 AAATGAAGTGGGGTGGTGGAGGG + Intergenic
1079006498 11:16794844-16794866 CAGGGTGGTGGGAGGGTGGAAGG - Intronic
1079344550 11:19640695-19640717 CAGTGTTCTGGGCAGGTGGCTGG + Intronic
1080621376 11:33990010-33990032 CAGTGCAGTGGGGGGCTGAAGGG - Intergenic
1081124996 11:39311739-39311761 CAGTGCAGTGGGGGGGCTGAAGG - Intergenic
1081672350 11:44949424-44949446 CAGGGTAGTGGGGCGGTGAGGGG + Intronic
1082089628 11:48078610-48078632 CAGTCTAGGAGGGAGGTGGCAGG + Intronic
1082801929 11:57421243-57421265 CAGGGTGGCGGGAAGGTGGAGGG - Intronic
1082851016 11:57764895-57764917 AAGGGTAGTGGGGAGTTGGAGGG - Intronic
1083538780 11:63496212-63496234 AAGGGTAGTGGGGAGGTGGGAGG - Intergenic
1084276486 11:68053951-68053973 CAGTCCAGTGATGAGGTGGATGG + Exonic
1084413892 11:69019374-69019396 CCTTTTAGTGGGGAGGTGCAAGG + Intergenic
1084451814 11:69243470-69243492 CAGTTGAGTGGGGGGATGGATGG - Intergenic
1084740042 11:71133560-71133582 GAGTGGAGGGGGGATGTGGATGG + Intronic
1084956791 11:72695864-72695886 CACTGGAGAGGGGAGGAGGAGGG + Exonic
1085214603 11:74817805-74817827 TACTTTGGTGGGGAGGTGGAAGG + Intronic
1085645389 11:78219164-78219186 CAGAGTAGAGAGGAGGTGGATGG + Exonic
1085658605 11:78340962-78340984 CATGGTAGTAGGGAGGTGGGAGG - Intronic
1086752539 11:90515560-90515582 AAGTGTAGTGGGGGGCTGGCTGG + Intergenic
1086870767 11:92033886-92033908 GGGTGAAGTGGGGAGGTGGGGGG - Intergenic
1086929925 11:92681835-92681857 CAGTGTGGGAGGGAGGAGGAGGG + Intronic
1087292421 11:96334589-96334611 CAGTGTAGACGGGAGGTGAGTGG - Intronic
1087354473 11:97076511-97076533 CAGTGCAGTGGGGGGGCTGAAGG - Intergenic
1088537764 11:110879914-110879936 CAGTGTGGTGGGGCTGGGGATGG - Intergenic
1089056984 11:115593688-115593710 TGGTGTTGTGGGGAGGAGGAGGG - Intergenic
1089155989 11:116402993-116403015 CAGTCACGTGGGGAGCTGGAAGG - Intergenic
1089373642 11:117978937-117978959 CAGTGCAGTGGGGGGGCTGAAGG + Intergenic
1089920200 11:122202647-122202669 CAGAGGAGTTGGGAGATGGAGGG - Intergenic
1090307751 11:125705152-125705174 CAGTGCAGTGGGGGGCTGAAGGG + Intergenic
1090359229 11:126161118-126161140 CAGTGAAGTGTGGAAGGGGAGGG - Intergenic
1090964117 11:131583300-131583322 CAGTATATTGGGGAGGTGGATGG - Intronic
1091026939 11:132149769-132149791 CAGTGTGGGAGGGAGATGGAGGG + Intronic
1091158296 11:133394546-133394568 AAGGGTAGTGGGGAGATGGAAGG - Intronic
1091233525 11:134003312-134003334 CAGTGCAGTGGGGGGCTGAAGGG + Intergenic
1091274859 11:134343074-134343096 CTCTGTGGTGGGGAGGAGGAGGG - Intronic
1091774735 12:3177026-3177048 CGGGGGAGTGGGGAGGTGGTGGG + Intronic
1091994018 12:4978713-4978735 GAGTGATGTGGGGAGGTGCATGG + Intergenic
1092047802 12:5444628-5444650 CAGTATGGTGGAGAGGTGGGCGG + Intronic
1092135141 12:6142107-6142129 CAGTGCAGTGGGGGGCTGAAGGG - Intergenic
1092159338 12:6307491-6307513 CAGACTAGTGGGGAGGCAGATGG - Intergenic
1092221329 12:6715947-6715969 CAGTGCAGTGGGGGGGCTGAAGG - Intergenic
1092617224 12:10226081-10226103 CAGTGCAGTGGGGGGGCTGAAGG + Intergenic
1094589373 12:31806238-31806260 CAGTGCAGTGGGGGGGCTGAAGG + Intergenic
1094661212 12:32472202-32472224 CAGTGCAGTGGGGGGCTGAAGGG - Intronic
1094813318 12:34162658-34162680 CAGTGTAGTTGGGGGTTGTAGGG - Intergenic
1095565115 12:43613846-43613868 TAGAGTAGTGGGGGGCTGGAGGG - Intergenic
1096325768 12:50659905-50659927 CAGAGATGTGGGGAGGTGGGTGG - Intronic
1096464688 12:51841783-51841805 CAGAGGAGTGGGGAGGAGAAAGG + Intergenic
1097107006 12:56631899-56631921 ATTTGTAGTGGGGGGGTGGAGGG - Intronic
1097259985 12:57713678-57713700 AAGTGGGGTGGGGCGGTGGAGGG - Intronic
1097621777 12:61947299-61947321 GACTGTGGTGGGGAGGTGGGAGG + Intronic
1098588601 12:72184951-72184973 CAGTGCAGTGGGGGGGCTGAAGG - Intronic
1098759173 12:74402857-74402879 CAGTGCAGTGGGGGGCTGAAGGG - Intergenic
1098998862 12:77153064-77153086 CAGTGTATGGGGGAGGGAGAAGG + Intergenic
1100521398 12:95379519-95379541 CAGTGCAGTGGGGGGCTGAAGGG - Intronic
1101245214 12:102878379-102878401 CAGTGTAGTGGGGAAGGGGTTGG + Intronic
1101703183 12:107194423-107194445 CAGTGTTGTGGGGAGGTATCAGG + Intergenic
1101743748 12:107522100-107522122 CAGGGTGGTGGGGTGGGGGAAGG + Intronic
1102353929 12:112216438-112216460 CAGGGAAGTGGTGAAGTGGAGGG + Intronic
1102554987 12:113720884-113720906 CAGAGTTGGGGGGAGGAGGAAGG + Intergenic
1102741063 12:115207926-115207948 GAGAGAAGAGGGGAGGTGGAGGG - Intergenic
1104540800 12:129662994-129663016 TAGTGTAGCAGGGAGCTGGAAGG - Intronic
1104549037 12:129739143-129739165 CGGTATAGTGAGGAGGTGGGTGG + Intronic
1104822379 12:131684573-131684595 CAGGGTAGTCGGGAGGGAGATGG - Intergenic
1105722114 13:23127487-23127509 CAGTGCAGTGGGGGGCTGAAGGG - Intergenic
1106023750 13:25938766-25938788 GAGTGTCGTGGGTAGATGGAAGG + Intronic
1106047334 13:26155449-26155471 CAGTGAAGTGGGGTGGAGGATGG + Intronic
1106093819 13:26624410-26624432 AAGTGGAGTGGGGAAGGGGAGGG + Intronic
1106617134 13:31340116-31340138 CAGTGCAGTGGGGGGCTGAAGGG + Intergenic
1106810879 13:33357891-33357913 CAGTGCAGTGGGGGGCTGAAGGG - Intergenic
1108514104 13:51181632-51181654 CAGTGGAGTGGGGAGGGCTAAGG - Intergenic
1108664401 13:52615529-52615551 AAGGGTAGTGGGGAGTTGGAGGG + Intergenic
1108958170 13:56187430-56187452 CAGTGTAGTGGTGGGCTGAAGGG - Intergenic
1109067756 13:57721677-57721699 GAGTGTAGTGTGGAGGGAGAAGG - Intronic
1109111085 13:58318985-58319007 CAGTGCAGCGGGGGGCTGGAGGG + Intergenic
1109441300 13:62379137-62379159 CAGTGCAGTGGGGGGCTGAAGGG - Intergenic
1110434034 13:75459259-75459281 CAGTGTTGTGGGGAAGGGAAAGG - Intronic
1110542546 13:76722184-76722206 CAGTTTCTTGGGGAGGTGGAAGG - Intergenic
1110802705 13:79718281-79718303 AAGTGTAGAGGGTAGGAGGAGGG - Intergenic
1110947437 13:81440439-81440461 AAGGGTAGTGGGGAGGAGGGGGG + Intergenic
1111363006 13:87200970-87200992 GAGTGTAGAGGGTAGGAGGAGGG + Intergenic
1111711500 13:91820476-91820498 CAGAGTAGTGGGATGGTGGTGGG - Intronic
1112488297 13:99839639-99839661 CAGAGTGGTGGGGAGGGGCATGG + Intronic
1113377987 13:109782434-109782456 AACTGTCGTGGGGAGGTGGGCGG + Exonic
1113390267 13:109889776-109889798 CAGGGTAGAGGGTAGGAGGAGGG + Intergenic
1113506569 13:110821070-110821092 CAGTGCAGTGGGGGGGCTGAAGG - Intergenic
1113532298 13:111037163-111037185 CAGTGAGGTGGGGAAGTGGGGGG + Intergenic
1114319855 14:21538256-21538278 CAGTGTATTGTGGAGATGGAGGG - Intergenic
1114398076 14:22384716-22384738 CAGTGTTGTGGGGAAGTTGAAGG + Intergenic
1114544538 14:23488928-23488950 CAGTTTAGTGGGGTGGGGAAAGG + Intronic
1114560381 14:23585332-23585354 CAGTGCAGTGGGGGGCTGAAGGG + Intergenic
1114640507 14:24216520-24216542 CAGTGTAGTGCTGACATGGATGG - Intronic
1114932587 14:27492559-27492581 GAGTGTTGTGGGGTGGGGGAGGG - Intergenic
1116606373 14:47001885-47001907 CAATGGAGTGGGGAGGGAGAGGG + Intronic
1116716352 14:48431381-48431403 CAGTGGAGAGGGGAGCTGGAAGG + Intergenic
1117322173 14:54634470-54634492 CAGGGTAGTGGGGACAGGGATGG + Intronic
1117499760 14:56339889-56339911 GAGAGAGGTGGGGAGGTGGAGGG + Intergenic
1117571994 14:57057065-57057087 CAGTGCAGTGGGGGGCTGAAGGG + Intergenic
1117772756 14:59151335-59151357 CAGGGTAGTGGCGATGGGGAAGG + Intergenic
1118240037 14:64047172-64047194 CAGTGGAGAGGGAAGCTGGAGGG + Intronic
1118730516 14:68662891-68662913 CAGAGCAGTGGGGAGGAGGATGG - Intronic
1119242691 14:73074566-73074588 CTGTCTTGTGGGGAGGTGGGGGG + Intronic
1119758941 14:77138127-77138149 CAGGGTAGGGAGGAAGTGGAAGG + Intronic
1121001831 14:90456648-90456670 CTGTGCAGTGGGGAGGTGGGAGG - Intergenic
1121016045 14:90549645-90549667 CAGTGGAGTGTGGAGGTTGGGGG + Intronic
1121611342 14:95282939-95282961 CAGAGGACTGGGGAGGGGGAGGG + Intronic
1122138377 14:99647436-99647458 CAGTGAGGTGGGCAGGTGGATGG + Intronic
1122393213 14:101404795-101404817 CAGAATAGTGGGGAGGTGGTGGG + Intergenic
1122493527 14:102135960-102135982 CAGTGCAGTGGGGGGCTGAAGGG + Intronic
1125240786 15:37573422-37573444 CAGTGTAGTAGGCATGAGGATGG - Intergenic
1125608525 15:40955987-40956009 TGGTGTGGTGGGCAGGTGGAGGG + Exonic
1125743226 15:41982052-41982074 AAGTGCAGTGGGGAGCTGGTTGG - Exonic
1126203865 15:46020044-46020066 CAGTGCAGTGGGGAAGTGTGAGG + Intergenic
1127147426 15:56038942-56038964 CAGTGTTGGGGGAAGGTGGGAGG - Intergenic
1127165938 15:56244566-56244588 GGGTGGGGTGGGGAGGTGGAGGG - Intronic
1127181358 15:56422092-56422114 AAGTGTTGTGGGGAGGGGGGAGG + Intronic
1127855740 15:62952272-62952294 CAGAATAGTGGGGGGGTGGGGGG + Intergenic
1127904020 15:63362884-63362906 AAGTATAGTGGGAAGGTCGAGGG + Intronic
1128562164 15:68676031-68676053 CAGGGGTGTGGGCAGGTGGAGGG + Intronic
1128737277 15:70060305-70060327 CACTGTGGGGCGGAGGTGGATGG - Intronic
1128796913 15:70472808-70472830 CAATGTAGAGGGAAGGAGGAAGG + Intergenic
1129281635 15:74489706-74489728 AAGTGTACAGGGGAGGTTGATGG + Intergenic
1129299593 15:74617957-74617979 CAAGTTAGTGGGGAGATGGAGGG + Intronic
1129302909 15:74636574-74636596 CAATGTAGGGAGGAGATGGACGG + Intronic
1129393631 15:75232937-75232959 ATGTGTAGTGGGGACGAGGACGG + Intergenic
1129859099 15:78846784-78846806 CAGTGCAGTGGGGGGCTGAAGGG - Intronic
1130010984 15:80152838-80152860 CAGGGTAGGGGGGAGGGGCAGGG + Exonic
1130289326 15:82583036-82583058 GAGAGTAGTGGGGAGGGTGAGGG - Intronic
1130749959 15:86701300-86701322 CATTGGAGAGGGGAGGTGAAGGG + Intronic
1131116920 15:89801569-89801591 CACGGTGGTGGGGAGTTGGATGG + Exonic
1132097644 15:98999960-98999982 CAGTGCAGTGGTGGGCTGGAGGG - Intronic
1132626452 16:893977-893999 CAGTGGGGTGGACAGGTGGATGG - Intronic
1132682004 16:1146265-1146287 CTGTGGAGTGGGAAGGAGGAGGG - Intergenic
1133583492 16:7169050-7169072 CAGTGTAGTTTGCATGTGGAGGG + Intronic
1133757760 16:8775516-8775538 CAGTGTAGTGGGTAAGAGTATGG - Intronic
1134112515 16:11524180-11524202 GAGGGTAGTGGGTGGGTGGATGG - Intergenic
1134248224 16:12555732-12555754 TGGAGTTGTGGGGAGGTGGAAGG - Intronic
1135082246 16:19446083-19446105 AAGAGTTGGGGGGAGGTGGAGGG + Intronic
1135421448 16:22308132-22308154 CAGGGTACTGGGGAGGGGAAGGG - Exonic
1135849774 16:25952848-25952870 CAGGGAAGTGGGGAGGTTTAAGG - Intronic
1136048803 16:27636218-27636240 CTGCCTAGTGGGGAGGAGGATGG - Intronic
1136272963 16:29159238-29159260 CAGTGGGGTGGGGGGGTGGTGGG + Intergenic
1136334516 16:29602663-29602685 CACGGTATTGTGGAGGTGGAAGG + Intergenic
1136397998 16:30003459-30003481 CAGGGGAGTGAGGAGATGGAAGG + Intronic
1137299458 16:47133720-47133742 CAGTGTGGTTGGCAAGTGGAAGG + Intronic
1137483468 16:48871947-48871969 CAGAGTGGTGGAGAGGTGAATGG - Intergenic
1137628914 16:49928346-49928368 GTGTGGAGTGGGGATGTGGAGGG - Intergenic
1137892312 16:52175449-52175471 GACTGTGGTGGGGAGGTGGGAGG + Intergenic
1137902105 16:52279883-52279905 CAGTGTAGTGGGGAGGAGCAGGG + Intergenic
1138519848 16:57564756-57564778 GAGGATAGTGGTGAGGTGGAGGG + Intronic
1138836846 16:60447841-60447863 CAGTGAAGTTGGTATGTGGAAGG + Intergenic
1139392446 16:66613368-66613390 CAGTGTCATGGGGAGCTGGGCGG + Exonic
1139409172 16:66745307-66745329 GAGTGTAGTGGTGTGGTGTAGGG + Intronic
1139667633 16:68468872-68468894 CAGGGAGGTGGAGAGGTGGAGGG + Intergenic
1139682054 16:68572802-68572824 CCCTGTAGTGTGGAGGTGGAAGG + Intronic
1140205917 16:72933319-72933341 CAGAGGAGTAGGAAGGTGGAGGG + Intronic
1140479221 16:75253475-75253497 CGGTGCAGAGAGGAGGTGGATGG + Intronic
1141050663 16:80760335-80760357 AAGGGTAGTGGGGGGTTGGAGGG + Intronic
1142035226 16:87858499-87858521 CACGGTATTGTGGAGGTGGAAGG + Intronic
1142044011 16:87913699-87913721 CAGTGTGGGGTGGAGGAGGAGGG - Intronic
1142749695 17:1979812-1979834 CAGTCAAGGGGGGAGGAGGAGGG - Intronic
1142950930 17:3479549-3479571 CAGTGCTGTGGGAAGGTAGAAGG - Intronic
1142950937 17:3479585-3479607 TGGTGCAGTGGGAAGGTGGAAGG - Intronic
1143548658 17:7615114-7615136 CAGTGTTGTGGGGCGGGGAAAGG - Intronic
1143731255 17:8884277-8884299 GAGAGCTGTGGGGAGGTGGAGGG - Intronic
1144533344 17:16061945-16061967 GAATGTGGTGGGGAGATGGAAGG + Intronic
1144669343 17:17124110-17124132 CAGAGAGGTGGAGAGGTGGAAGG + Intronic
1144702403 17:17348127-17348149 AAGGTTAGTGGGGAGGTGGCTGG - Intergenic
1145928713 17:28668165-28668187 AAGGGCAGTGGGGAGATGGAGGG - Intronic
1146018155 17:29249965-29249987 CAGAGTAGGGATGAGGTGGAGGG - Intronic
1146095982 17:29930409-29930431 CTGTGGAGTGGGGTGGGGGAAGG + Intronic
1146682162 17:34816206-34816228 CAGTGGGGTGGGGAGGGGGCTGG - Intergenic
1146941092 17:36845065-36845087 CAGTGTGGTGGGGAGGTGTCTGG + Intergenic
1147167571 17:38601591-38601613 CTGTGGTGTGGGGAGGGGGATGG + Intronic
1147498370 17:40938869-40938891 CAGTGTTCTGTGGATGTGGACGG + Intergenic
1147652561 17:42070898-42070920 GAGGGCAGTGGGGAGGTGGCAGG - Intergenic
1147850016 17:43435188-43435210 CAGTGTCAAGGGGAGGTGGATGG + Intergenic
1148583164 17:48757573-48757595 CACTGTGCTGGGGAGGTGGCTGG - Intergenic
1148835734 17:50464848-50464870 CAGTGTCCTGGGGAGAAGGAAGG - Exonic
1149142834 17:53455200-53455222 AAGAGTAGTGGGGAAGTAGAGGG - Intergenic
1149882955 17:60310995-60311017 AAGAGTAGTGGGGAGGAGGGGGG + Intronic
1149992460 17:61390585-61390607 GAGTGGAGTGGGGAGGAGGCGGG - Intronic
1151182664 17:72340864-72340886 CAGTTTAGATGGGAGGAGGATGG + Intergenic
1152013734 17:77736040-77736062 GAGAGGAGTGGGGAGGTGGCAGG + Intergenic
1152197529 17:78925950-78925972 CAGTTTAGTTGGGGGGTGGGGGG + Intergenic
1152327836 17:79651855-79651877 CAGTGATGGGGGGTGGTGGAGGG - Intergenic
1153832535 18:8935872-8935894 CAGTGCAGTGGGGGGCTGAAGGG + Intergenic
1155058184 18:22204001-22204023 CAGTGTAGTGGGGAGAAAGGTGG + Intergenic
1155364572 18:25036825-25036847 CTGTGGTGTGGGGAGGTGGCAGG + Intergenic
1155697688 18:28702160-28702182 CAGGTAAGTGGGTAGGTGGAGGG + Intergenic
1156043909 18:32856802-32856824 GACTGTGGTGGGGAGGGGGAAGG - Intergenic
1157559245 18:48634734-48634756 CAGTATAGTGGGGATGGGCAAGG + Intronic
1158185116 18:54762717-54762739 CGGTGTGTTGGGGAGGAGGAAGG - Intronic
1158543081 18:58374467-58374489 CAGTGGGGTGGGGAGGAGGCCGG - Intronic
1159010390 18:63053739-63053761 CAGTGGAGTGGAGAGTTGGTAGG - Intergenic
1159636729 18:70813580-70813602 AAGAGTAGTGGGGAGGGAGAGGG - Intergenic
1160319274 18:77875138-77875160 GAGGGCTGTGGGGAGGTGGAGGG - Intergenic
1160534592 18:79585416-79585438 GGGTGCAGTGGGGAGGTGCAGGG - Intergenic
1160960436 19:1718481-1718503 GGGTGCAGTGGGGAGGGGGAGGG + Intergenic
1161040782 19:2109814-2109836 CAAGGTAGAGGGGAGGCGGAGGG + Intronic
1161151587 19:2713007-2713029 GATGGTGGTGGGGAGGTGGAGGG - Intergenic
1161245383 19:3249043-3249065 CTGTGTGGTGGGGAGGGGGTAGG - Intronic
1161974054 19:7599257-7599279 GAGTGCAGTGGGTAGGTGGGTGG - Intronic
1161974100 19:7599424-7599446 GAGTGCAGTGGGTAGGTGGGTGG - Intronic
1162112123 19:8404945-8404967 CACTGCAGGGGTGAGGTGGAGGG - Intronic
1162760892 19:12887559-12887581 CTGTTTACTGGGGAGGGGGAGGG - Intergenic
1162927491 19:13937719-13937741 CAGTGGTGAGGGGAGCTGGAGGG - Intronic
1163160412 19:15461027-15461049 CAGTGAAGGTGGGAGGTAGAGGG - Intronic
1163383570 19:16985382-16985404 AAGTGTAGTGGGTGGATGGATGG + Intronic
1163479157 19:17544463-17544485 CAGTGGAGGGAGGAGGTGGATGG + Intronic
1163761082 19:19137224-19137246 CTGAGCTGTGGGGAGGTGGAGGG - Intronic
1163862612 19:19750116-19750138 CTGTGTAGGGTGGATGTGGAAGG - Intergenic
1164037387 19:21466797-21466819 TAATGTAGTGGGGAGGAGCAAGG - Intronic
1164143105 19:22492152-22492174 AGCTGTAGTGGGAAGGTGGAGGG - Intronic
1165407511 19:35639790-35639812 CTGTGCAGTGGGAAGGGGGACGG + Intergenic
1166046382 19:40233190-40233212 CAGTTTGGTGGGGAGGAGGCCGG + Exonic
1166666684 19:44684381-44684403 AAGTGTATTGGGGAAATGGAGGG + Intergenic
1167074412 19:47240003-47240025 CAGGGGAGCAGGGAGGTGGATGG - Intergenic
1167277824 19:48549638-48549660 CAGTCTAGTGGGGAGATAGATGG + Intergenic
1167461363 19:49626142-49626164 CAGGGGCTTGGGGAGGTGGAGGG + Exonic
1167720441 19:51176268-51176290 CAGGACAGTGGGGAGGTGGCTGG - Intergenic
1167867091 19:52337178-52337200 CAGAGTAGGGGAGAGGAGGAGGG + Intronic
1168287843 19:55343202-55343224 CAGTCTGGTGAGGAGGTGGGGGG + Intronic
925094100 2:1181059-1181081 GACTGTAGTGGGGTGGGGGAAGG + Intronic
925121420 2:1421524-1421546 CAGAGTCCTGGGGAGGTGGGGGG + Intronic
926536761 2:14122706-14122728 GAGTGCAGTGGGGAGATTGAAGG + Intergenic
926757819 2:16250215-16250237 CAGAGTGGAGGTGAGGTGGAGGG + Intergenic
927152577 2:20204309-20204331 GAGTGTGTTGGGGAGGTGGGGGG + Intronic
927562865 2:24085664-24085686 CAGTGTAGGGGGTCAGTGGATGG - Intronic
927678418 2:25123750-25123772 CAGGGTGGTGGGGGAGTGGATGG + Intronic
928243390 2:29606016-29606038 CAGTGGGGGTGGGAGGTGGAAGG - Intronic
928363571 2:30684947-30684969 CTGGGGAGTGGGGAGGGGGAAGG + Intergenic
928652664 2:33419016-33419038 GAGGGTAGCGGGTAGGTGGATGG + Intergenic
928707345 2:33964579-33964601 AAGGGTAGTGGGGGGCTGGAGGG - Intergenic
929284934 2:40125275-40125297 GGGTGTAGCGGGGAGGAGGAAGG + Intronic
929469996 2:42182300-42182322 CAGTGGAGGGGGGAGGGGGGAGG - Intronic
929567825 2:43000701-43000723 CAGTGTTGTGGGGAGAGGGATGG - Intergenic
930217894 2:48715710-48715732 CTGTGTTGTGGGTTGGTGGAAGG - Intronic
932239868 2:70148239-70148261 CAGTGCAGTGGGGGGCTGAAGGG - Intergenic
932441870 2:71742720-71742742 CAGTGAGTTGGGGAGATGGAGGG - Intergenic
932486405 2:72086801-72086823 CAGTGCAGTGGGGGGGCTGAAGG - Intergenic
934176108 2:89581757-89581779 CAGAGTATTGAGGAGGTGGAGGG + Intergenic
934286418 2:91656119-91656141 CAGAGTATTGAGGAGGTGGAGGG + Intergenic
934739932 2:96712891-96712913 CAGGGTAGTGAGGTGGTGAAGGG + Intronic
935282129 2:101527334-101527356 GAATGTGGTGGGGAGGTGGGTGG + Intergenic
935366160 2:102293103-102293125 CAGTGCAGTTGGCAGGTGGAGGG + Intergenic
935690989 2:105732444-105732466 GAGTAAAGTTGGGAGGTGGAAGG - Intergenic
936241346 2:110790977-110790999 CAGGGAAGTGGGGAAGTAGAGGG - Intronic
936490981 2:112971956-112971978 CAGTGGAGTGGGGTGGGAGAAGG - Intergenic
937197988 2:120177163-120177185 CAGTGTGGTGGGGAGAGGCAGGG + Exonic
937676136 2:124593284-124593306 GACTGTGGTGGGGAGGTGGGAGG - Intronic
938137288 2:128769904-128769926 CAGTGTGAAGGAGAGGTGGAAGG + Intergenic
938923230 2:136014684-136014706 CAGCAGAGTGGGGAGGTAGAGGG - Intergenic
938995731 2:136675492-136675514 GTGTGTAGTGGGGAGGGGGGTGG - Intergenic
939995362 2:148914841-148914863 CAGTGGAGTGGAGAGGAGAATGG + Intronic
941037288 2:160582173-160582195 GAGTGGAGTGGGGAAGGGGAAGG + Intergenic
941047328 2:160691194-160691216 CAGTGGGGGTGGGAGGTGGAGGG + Intergenic
942068318 2:172292812-172292834 CAGTGTTGTGGGGAGGTAATAGG - Intergenic
942264723 2:174211164-174211186 GTGTGTTGTGGGGAGGAGGAAGG - Intronic
943016080 2:182512095-182512117 TAGGGTAGTGGTGAGGTGGTGGG - Intronic
943455662 2:188103645-188103667 CAGTGCAGTGGGGTGCTGGTAGG - Intergenic
945297327 2:208183559-208183581 CAGTGTGGTGGGAATTTGGAGGG + Intronic
946109381 2:217401059-217401081 CAGTGGATTGGGGAGATGGTGGG - Intronic
946129587 2:217595857-217595879 CATTGTAGTGGGGCTGAGGATGG - Intronic
946464430 2:219898661-219898683 CACAGCAGTGGGGGGGTGGAGGG + Intergenic
946634035 2:221704837-221704859 AAGTGTATTTGGGAGGAGGAGGG - Intergenic
947694857 2:232176954-232176976 GACTGTGGTGGGGAGGTGGGAGG - Intronic
947931327 2:233967759-233967781 CAGTGTAGTGGGTAGAAGTAAGG + Intronic
948549551 2:238760874-238760896 GAGGGCAGTGGGGATGTGGATGG + Intergenic
1169082732 20:2807091-2807113 CAGAGTGGTGGGAAGGGGGATGG - Intergenic
1170236568 20:14112214-14112236 AAGGGTAGTGGGGGGTTGGAGGG + Intronic
1171985117 20:31654798-31654820 AACTGTAGAGGGTAGGTGGATGG - Intergenic
1172039878 20:32036309-32036331 CAGGGAAGTGGGGAGGAGGCTGG + Intergenic
1172808074 20:37627409-37627431 CACTGTTGTGGGGAGAGGGACGG - Intergenic
1173288236 20:41692075-41692097 AAGTGTAGGGGTGAGGTGGGAGG + Intergenic
1173336960 20:42119944-42119966 CAATGTAGTGCCGAGGTCGATGG + Exonic
1173435452 20:43028382-43028404 CAGGGAAGTTGGGAGGTGGGAGG - Intronic
1173571413 20:44079137-44079159 CAGGGGAGTGGGGAGTAGGAGGG + Intergenic
1173971932 20:47159957-47159979 CAGTGTAGTGAGGAGAGGGTAGG + Intronic
1173976504 20:47190641-47190663 CAGTTTAATGGGCAGGTGGATGG + Intergenic
1174033429 20:47650033-47650055 CAGTGTGTTGGGGTGGTGGAGGG - Intronic
1174102852 20:48140288-48140310 GAGTTTAGTGGTGAGGTGGTGGG - Intergenic
1174127243 20:48315611-48315633 GTGTGGGGTGGGGAGGTGGAGGG + Intergenic
1175050315 20:56149646-56149668 AAGTGCAGTGGTGAGGTGCATGG - Intergenic
1175608208 20:60328687-60328709 CTGTGAATTAGGGAGGTGGAGGG - Intergenic
1175625222 20:60484010-60484032 CAGGAGAGTGGGGAGGGGGAGGG - Intergenic
1175654763 20:60760533-60760555 CTCTGTAGTGGGGAGGTGGGTGG - Intergenic
1175740185 20:61414621-61414643 CCGTGTGATGGGGTGGTGGAGGG + Intronic
1176676650 21:9784767-9784789 AAGAGTGGTGAGGAGGTGGAGGG + Intergenic
1176966691 21:15219025-15219047 CAGTGCATTGGGGGGGTGGGTGG + Intergenic
1178398672 21:32265242-32265264 CAGTGCAGTGGGGGGCTGAAGGG - Intergenic
1178498177 21:33104342-33104364 CAGGGAAGTGGGGAGCAGGAAGG + Intergenic
1178808164 21:35856732-35856754 AAGGGTAGTGGGGAGGTCGAGGG + Intronic
1179143140 21:38744863-38744885 CAGTGTTTTGGGGAGGGGGGAGG - Intergenic
1179417666 21:41211172-41211194 CAGTGAAGGGGGGAGAGGGATGG - Intronic
1179441048 21:41394359-41394381 CAGCCTAGTGGGGAGGGAGAAGG - Intronic
1179714297 21:43279870-43279892 AAGTGTCGAGGGCAGGTGGAGGG + Intergenic
1180728893 22:17966419-17966441 CAGAGGAGTGAGGAGGTGGAGGG - Intronic
1180999414 22:19981142-19981164 CTCTGTAGTTGGGGGGTGGAGGG + Intronic
1181858760 22:25801941-25801963 CAGGGTACTTGGGAGGTGGGAGG - Intronic
1182285306 22:29243587-29243609 GGCTGTAGTGGGGATGTGGATGG - Intronic
1183494609 22:38135483-38135505 CAGTGTGGTAAGGAGGTGGAGGG - Intronic
1183645629 22:39124372-39124394 CAGTGAAGCTGGGAGGTGGACGG + Intronic
1184309766 22:43633720-43633742 CGGTGTGGTGGGCAGATGGATGG + Intronic
1185389211 22:50549745-50549767 CAGTGCAGTGGGGCGGGGGCGGG - Exonic
950256722 3:11512045-11512067 CAGTGCAGTGGGGGGCTGAAGGG + Intronic
950630608 3:14279419-14279441 GTAAGTAGTGGGGAGGTGGAAGG + Intergenic
950707063 3:14789431-14789453 CACTCTAGTGGGGAGGCTGACGG - Intergenic
951223785 3:20097209-20097231 CAGGGTAGTGGGGAGCTGCCAGG - Intronic
951505938 3:23445000-23445022 CATGGGAGTGGGGAGGTAGAGGG - Intronic
951519749 3:23600247-23600269 CAGAGTAATGGGAAGGTGTAAGG - Intergenic
951760579 3:26143244-26143266 AAGGGTAGTGGGGTGTTGGAGGG + Intergenic
952132950 3:30385298-30385320 CAGTGTGGAGGGAAGGGGGAAGG + Intergenic
952228047 3:31399433-31399455 CAGTGTAGTTGGGGTGTGAATGG - Intergenic
952927888 3:38335145-38335167 CAGTAGGGTAGGGAGGTGGAAGG + Intergenic
953316932 3:41936768-41936790 AAGGATAGTGGGGAGGTGGTGGG + Intronic
954115437 3:48464648-48464670 CAGTGTAATGTGGAGGTGAGTGG + Exonic
954326168 3:49865341-49865363 CCGTGTACTGGGCAGGAGGATGG + Intronic
954633642 3:52059849-52059871 CAGTGTGGTGTGGTAGTGGATGG - Intergenic
954817111 3:53291467-53291489 AAGGGTAGTGGGAAGGTGGGGGG - Intronic
955058299 3:55474855-55474877 AAGAATAGTGGGGAGGTAGAAGG + Intronic
955316591 3:57944198-57944220 CAGAGCAGTGGGGGGCTGGAAGG - Intergenic
955449416 3:59050769-59050791 CAGTGCAGTGGGGGGCTGAAGGG - Intergenic
955525001 3:59810712-59810734 CAGTGTACTTTGGAGGGGGAGGG - Intronic
956350765 3:68333475-68333497 GAGTGTAGAGGGTGGGTGGAGGG + Intronic
957698760 3:83681097-83681119 CAGTGTAGGGGTGGGGTGGAGGG + Intergenic
958473778 3:94554435-94554457 TTGTGTGGTGGGGTGGTGGAGGG + Intergenic
958530328 3:95321570-95321592 GAGTGTAGTAGGCTGGTGGAAGG - Intergenic
959548805 3:107630384-107630406 CAAAGGAGTGGGGAGGAGGAGGG - Intronic
960392163 3:117090722-117090744 CATTAAAGTGGGAAGGTGGAAGG + Intronic
960928757 3:122822961-122822983 CAACACAGTGGGGAGGTGGAGGG - Intronic
960953360 3:123013820-123013842 CAGGGAAGAGGGGAGCTGGAGGG + Intronic
962398816 3:135039866-135039888 CAGTGCAGTGGGGGGGCTGAAGG + Intronic
963054983 3:141179072-141179094 CAGGGAAGTGGGGAGGTCAATGG - Intergenic
963475632 3:145800006-145800028 GAGTGTAGTGGGGGTGTGGGAGG - Intergenic
963701894 3:148637087-148637109 AAATGTAGTGGGAAGGTGGGCGG + Intergenic
964139290 3:153378785-153378807 CAGTGCAGTGGGGGGGCTGAAGG + Intergenic
964270987 3:154956659-154956681 CAGTGAAGTGGGGAAGTGGGTGG + Intergenic
964479461 3:157127446-157127468 CAGTGGGGTGGGGAGGTGCAGGG + Intergenic
964974103 3:162599610-162599632 CAGTGTAGTGGCGAGCTGAAGGG - Intergenic
965003375 3:162986640-162986662 GAATGTAATGGGGAGGTGGAGGG - Intergenic
965491422 3:169341383-169341405 AAGGGTAGTGGGGAGGTTGGCGG + Intronic
965753300 3:171999320-171999342 CAGTGCAGTGGGGGGCTGAAGGG + Intergenic
966259162 3:177954601-177954623 TAGTACAGTGGGGAGATGGATGG + Intergenic
966279996 3:178215012-178215034 AAGAGGAGTGGGGAGGGGGAAGG - Intergenic
967281641 3:187829045-187829067 CAATGTGGAGGGGAGGTTGAAGG + Intergenic
967774127 3:193368746-193368768 CAGTGGGGTGGGGCGGTGGGGGG - Intronic
967847925 3:194058558-194058580 GAGGGGAGTGGGGAGGGGGACGG + Intergenic
968181668 3:196599486-196599508 CAGTGCAGTGGGGGGCTGAAGGG + Intergenic
968403555 4:318939-318961 CAGTGTTGTAGGTAGGTGAAAGG + Intergenic
968957481 4:3726706-3726728 CAGGGCAGTGGGGCGGTGGGTGG - Intergenic
969125528 4:4945205-4945227 CAGTGTAGGGTGGAAGTGGCTGG + Intergenic
969424430 4:7115946-7115968 CAGTGTGGAGGTGATGTGGAGGG + Intergenic
969643683 4:8413636-8413658 CAGTGCTGTGGAGGGGTGGAGGG - Intronic
969719964 4:8888205-8888227 CTGTGGGGTGCGGAGGTGGAGGG - Intergenic
970471665 4:16385441-16385463 GAGTGCAGTGGGGAGGTAGTGGG + Intergenic
970476217 4:16426643-16426665 CATCGTGGTGGAGAGGTGGAGGG + Intergenic
970924448 4:21434738-21434760 CAGGGTTGTGGGGAGGGGGGCGG - Intronic
971809528 4:31406161-31406183 CAGAGTAGTGGGGATGAGCAGGG + Intergenic
971811883 4:31438563-31438585 CAGTGCAGTGGGGGGCTGAAGGG - Intergenic
972242558 4:37208942-37208964 CATGGTAGTGTGGAGGTGGAGGG - Intergenic
972709686 4:41582513-41582535 CAGTGTAGTGGTAAGGGGTAGGG + Intronic
972778550 4:42265851-42265873 CAGTGCAGTGGGGAGGCTGAAGG - Intergenic
973553304 4:52056752-52056774 GAGTCTGGTGGGGAGGTAGATGG - Intronic
973677970 4:53285933-53285955 CGGGGTTGTGGGGAGGTGGTGGG - Intronic
973774948 4:54233728-54233750 CAGGGGAGTGTGGAGGAGGACGG + Intronic
975007914 4:69313486-69313508 CAGAGTAGGAGGAAGGTGGAGGG - Intronic
975010110 4:69340272-69340294 CAGAGTAGGGGGAAGGTGGAGGG + Intronic
975356895 4:73417379-73417401 CAGAGTAGTGGGTTAGTGGAGGG - Intronic
975568993 4:75792818-75792840 CAGGGTAGTGGGAAGTTAGAGGG - Intronic
975668311 4:76755121-76755143 CAGTGTGGGGAGGAGGTGGAGGG - Exonic
976222484 4:82768853-82768875 AGGTGTAGTGTGAAGGTGGAAGG + Intronic
976520697 4:86022057-86022079 CAGTGCAGTGGGGGGCTGAAAGG + Intronic
976646932 4:87396395-87396417 CAGTGCAGTGGGGGGCTGAAGGG + Intergenic
978207254 4:106092840-106092862 CAGTGCAGTGGCGAGCTGAAGGG + Intronic
979424817 4:120551186-120551208 CAGTGCAGTGGGGGGGCCGAAGG + Intergenic
979829290 4:125280861-125280883 CAGTGCAGTGGTGAGCTGAAGGG - Intergenic
981191722 4:141872293-141872315 CAGTGCAGTGGGGAAGTGTGGGG - Intergenic
981326260 4:143451308-143451330 CAGAGTCGTGGGGAGGTAGGTGG + Intronic
981509572 4:145541109-145541131 CAGGTTAGTGGTGAGGAGGAAGG - Intronic
982740734 4:159054486-159054508 CAGTGTGGTGGGGAGTGAGAGGG - Intergenic
984217318 4:176930630-176930652 CAGTGTTGGGGGAAGCTGGATGG + Intergenic
984677670 4:182568977-182568999 TGGAGTAGTGGGGAGGAGGAAGG + Intronic
984713498 4:182905063-182905085 CAGAGAAGTGGGGTGGTGGCTGG - Intronic
984829319 4:183956997-183957019 CAGTGTTGTGGGGTGGGGGTGGG + Intronic
985063373 4:186099410-186099432 GACTGTTGTGGGGTGGTGGAGGG - Intergenic
985117258 4:186604726-186604748 GAGTGTGGTGGTGAGGAGGAGGG + Intronic
985398887 4:189574001-189574023 AAGAGTGGTGAGGAGGTGGAGGG - Intergenic
985624184 5:976468-976490 CAGGGTCTGGGGGAGGTGGATGG + Intergenic
986151935 5:5137697-5137719 CAGTGCAGTGGGGAGCTGAAGGG - Intergenic
986222381 5:5780503-5780525 CACTGTGGCGGGGAGGTTGATGG + Intergenic
986255969 5:6101604-6101626 CCGTGCAGTGGGGAGGTCCATGG - Intergenic
986672467 5:10154902-10154924 CATTGTGGGTGGGAGGTGGAGGG - Intergenic
986790251 5:11152718-11152740 CAGTGGAGTGAGGAGGAGTAAGG - Intronic
987147732 5:15008794-15008816 CAGTGATGTGGGAAGGTGGGAGG + Intergenic
987252922 5:16118854-16118876 CAGGGCAGTGAAGAGGTGGAAGG + Intronic
987364973 5:17140840-17140862 CAGTGCAGTGGGGGGCTGAAGGG - Intronic
987876883 5:23691036-23691058 CAGTGCAGTGGGGGGCTGAAGGG - Intergenic
988039390 5:25870232-25870254 AAGTGTAGTGGGTAGGTCGGGGG - Intergenic
988073421 5:26324333-26324355 CAGTGCAGTGGTGGGGTGAAGGG - Intergenic
988389595 5:30610412-30610434 CACTGTTGTGGGGTGGTGGGAGG + Intergenic
988691753 5:33579583-33579605 TAGTTCAATGGGGAGGTGGAGGG - Intronic
989154910 5:38335393-38335415 AAGAGTAGTGGGAAGTTGGATGG - Intronic
989553755 5:42766761-42766783 AAGGGTAGTGGGGGGCTGGAAGG + Intronic
990168131 5:53017836-53017858 CAGTGTTGGGGGGATGTGGAGGG + Intronic
990988376 5:61661790-61661812 GAGTGTAGGTGGGAGGGGGAAGG + Intronic
992162541 5:74016866-74016888 CAGTGTAAGGGGGAGGTGAATGG + Intergenic
992401318 5:76414323-76414345 CAGTTTAGGGGGCAGGTGAATGG - Intronic
992652407 5:78872658-78872680 GACTGTGGTGGGGAGGGGGAGGG + Intronic
993814346 5:92522774-92522796 GAGTGTGGTGGGGGGTTGGAGGG - Intergenic
994248922 5:97514062-97514084 GACTGTGGTGGGGAGGTGGGAGG - Intergenic
995266848 5:110172212-110172234 GACTGTAGTGGGGTGGGGGAAGG - Intergenic
995301538 5:110590549-110590571 GAGTGGAGTGGGGTGGGGGATGG - Intronic
995596520 5:113753566-113753588 CAGTGCAGTGGGGGGCTGAAGGG + Intergenic
997200564 5:132007613-132007635 CAGTGTTGTGGGAGGATGGAAGG + Intronic
997904386 5:137800843-137800865 GAGGGTAGTGGGTAGGAGGAGGG - Intergenic
998417316 5:141955386-141955408 CAGGGTCGGGGTGAGGTGGAAGG + Exonic
999409156 5:151335295-151335317 CAGTGGAGTGGGCAGGTGCATGG + Intronic
1000029457 5:157389624-157389646 CAGTGTAGTGGGGGTGAGGCAGG - Intronic
1001209188 5:169794290-169794312 AAGAGGAGTGGGGAAGTGGAGGG - Intronic
1001403670 5:171461204-171461226 GAGGGCAGTGGGGAGGGGGAGGG + Intergenic
1001403679 5:171461222-171461244 GAGGGCAGTGGGGAGGGGGAGGG + Intergenic
1002489569 5:179565088-179565110 TAGTGTATAGGGGAGGGGGATGG + Intronic
1003060658 6:2860056-2860078 CAGTGCAGTGGGGGGGCCGAAGG - Intergenic
1003256986 6:4483234-4483256 CTGTGTGGTGGGGAGGGGGTGGG - Intergenic
1003715611 6:8642914-8642936 AAGTGTAATGGGGTGGTGGGGGG + Intergenic
1003736830 6:8887079-8887101 CAGTGCAGTGGGGGGCTGAAGGG - Intergenic
1003774872 6:9348944-9348966 CAGTGCAGCTGGGTGGTGGAAGG + Intergenic
1003984035 6:11417443-11417465 CAGTGCAGTGGCGAGCTGAAGGG + Intergenic
1005035636 6:21552732-21552754 CAGTGCAGTGGGGGGCTGAAGGG + Intergenic
1005332947 6:24766384-24766406 CAGTGCAGTGGGGGGCTGAAGGG + Intergenic
1005675932 6:28154855-28154877 GTGTACAGTGGGGAGGTGGAAGG - Exonic
1005759739 6:28957757-28957779 CAGTGCAGTGGGGGGGCTGAAGG - Intergenic
1006183128 6:32165888-32165910 TAGGTTAGAGGGGAGGTGGAGGG + Intronic
1006194086 6:32227234-32227256 CAGAGAAGTGGTTAGGTGGAAGG + Intergenic
1006227130 6:32548371-32548393 CAGTGCAGTGGGGCGCTGAAGGG + Intergenic
1006272316 6:32973703-32973725 TTGTGTAGTGGGTGGGTGGAAGG + Intronic
1006352575 6:33532302-33532324 CAGTGCAGTGGGGGGCTGAAGGG - Intergenic
1007067607 6:39007785-39007807 CAGTGGGGTGGGGTGGTGGGAGG - Intronic
1007158681 6:39771234-39771256 CAGGGTAGGGTGGAGGAGGATGG - Intergenic
1007742449 6:44021191-44021213 CAGTGTAGTGGTGACGGGGGTGG - Intergenic
1008190804 6:48454495-48454517 AAGGGTAGTGGGGAATTGGAGGG - Intergenic
1008221683 6:48862262-48862284 TAGTGTAGTGGGGTGATGAAGGG - Intergenic
1009880189 6:69557108-69557130 GACTGTGGTGGGGAGGTGGGAGG + Intergenic
1011143622 6:84189280-84189302 CAGTGCAGTGGGGGGCTGAAGGG - Intronic
1011399988 6:86950393-86950415 CAGTGTGGTGGGAAGGTCCATGG + Intronic
1011878154 6:91988597-91988619 AAGTGTAGTGGGGGGTTGGGAGG + Intergenic
1012248077 6:96948766-96948788 AATTGCATTGGGGAGGTGGAGGG - Intronic
1012738734 6:102985241-102985263 GAGTCTAGTGGAGAGGTGGTAGG + Intergenic
1012950164 6:105509742-105509764 GTGTGGGGTGGGGAGGTGGAAGG + Intergenic
1013143636 6:107364693-107364715 CAGTGCAGTGGGGGGGCTGAAGG + Intronic
1013270074 6:108537257-108537279 CAGTCTAGTGTGGAGGTGGTGGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013707455 6:112854903-112854925 GATTGGAGTGGGGAGGTGGAGGG + Intergenic
1015325502 6:131918937-131918959 CAGTGTGGGGAGGGGGTGGATGG - Intergenic
1016132016 6:140485697-140485719 AAGTGGAGAGGGAAGGTGGAAGG - Intergenic
1016181533 6:141153613-141153635 CAGGGTAGGGGGGCGGGGGAGGG - Intergenic
1016578502 6:145600405-145600427 CAGTGGTGTGAGGGGGTGGAAGG - Intronic
1017680406 6:156858223-156858245 AAGTGTAGTGGAGAGATGGGAGG + Intronic
1017806520 6:157951348-157951370 AAGTGTAGTGGGGAGACTGAAGG + Intergenic
1018127452 6:160695449-160695471 CAGTGTAGTGAGGAGGTCATAGG - Intergenic
1019000336 6:168744233-168744255 CAGTGCAGTGGGGGGCTGAAGGG + Intergenic
1019130920 6:169873860-169873882 AAGGGTAGTGGGGAGGTGTGTGG - Intergenic
1019791958 7:3020160-3020182 CAGTGTAGTGGTGAAGTGTGGGG - Intronic
1020398984 7:7753409-7753431 AAGAGTAGTGGGGAGTTGGGGGG - Intronic
1021115736 7:16744702-16744724 CAGTGGAGAGGGGAAGTGGTGGG + Intergenic
1021237924 7:18165904-18165926 CATTTTTATGGGGAGGTGGATGG + Intronic
1021324055 7:19245396-19245418 CAGTGCAGTGGGGGGCTGAAGGG - Intergenic
1021784245 7:24136516-24136538 CAGTGGGGAGGGGAGGTGGCTGG - Intergenic
1022084980 7:27057884-27057906 CAATCTAGTGTGGAGGTGGTTGG - Intergenic
1022801247 7:33779492-33779514 CAGTGTAGGGGGAAGGGGGAGGG + Intergenic
1023193021 7:37603284-37603306 CAGTGTTGTGGGGAGAAGGGTGG - Intergenic
1023208098 7:37773173-37773195 AAGGGTAGTGGGGAAGTGGCAGG - Intronic
1023525288 7:41096122-41096144 CAAAGTGGTGGGGAGGTGGGAGG + Intergenic
1023878442 7:44305582-44305604 CAGTCTCCTGGGGAGATGGACGG + Intronic
1023909668 7:44544448-44544470 AAGAGTAGTGGGGAGGTAGGGGG + Intergenic
1024009940 7:45258950-45258972 AAGGGTGGTGTGGAGGTGGAGGG + Intergenic
1024029057 7:45441252-45441274 AAGGGCAGTGGGGAGGTGCAGGG + Intergenic
1024498807 7:50078244-50078266 AAGTGTAGTGGGGAGTTTTAGGG + Intronic
1024833977 7:53494933-53494955 CAGTGCAGTGGTGGGCTGGAGGG - Intergenic
1025594599 7:62909024-62909046 GAGTGTTGTGGGGTGGTGGGTGG - Intergenic
1025973040 7:66345965-66345987 AAGGGTAGTGGGTAGGTGGGTGG - Intronic
1026145055 7:67739505-67739527 CTTTTTAGTGGGGACGTGGAGGG + Intergenic
1026187158 7:68090862-68090884 CAGTGCAGTGGGGGGGCTGAAGG + Intergenic
1027665824 7:81042621-81042643 CAGTGCAGTGGGGGGCTGAAGGG - Intergenic
1028007549 7:85593893-85593915 CAGTGAAGTGGGGGGGCGGGGGG + Intergenic
1028143971 7:87301129-87301151 GAGTGTAGAGGGAAGGAGGAAGG + Intergenic
1029432450 7:100539727-100539749 CGGTGTGGTGGGGAGGGGAAAGG + Intronic
1029458019 7:100680701-100680723 CAGTGAAGGGGGCAGGAGGAGGG - Exonic
1030379945 7:108800668-108800690 GAGAGTAGAGGAGAGGTGGAGGG - Intergenic
1030546879 7:110907285-110907307 CAGTGTAAAGGGGAGCTGAAAGG + Intronic
1031701496 7:124931630-124931652 AAGTGTAATGGGGTGGTGGGGGG - Intergenic
1031999185 7:128253875-128253897 CAGTGCTGTGGGCAGATGGATGG + Intronic
1032283429 7:130524133-130524155 CAGGGTTGTGGGGTGCTGGAAGG + Intronic
1032284170 7:130528359-130528381 CAGGGTTGTGGGGTGCTGGAAGG + Intronic
1032704165 7:134407792-134407814 GAGTGGGGTGGGGAGGGGGAAGG - Intergenic
1033605092 7:142921239-142921261 GAATGTAGTGGGGAGATAGAGGG - Intronic
1034154947 7:148948993-148949015 CAGTGCAGTGGGGGGCTGAAGGG - Intergenic
1035417949 7:158705134-158705156 CGGTGTTGTGGGAAGGAGGAAGG + Intergenic
1036585855 8:10122677-10122699 GAGTGTAGAGGGCAGGAGGAAGG - Intronic
1036686964 8:10918183-10918205 CAGGGTCCTGGGGAGCTGGAGGG + Intronic
1036773160 8:11592629-11592651 TGGTGTGGTGGGCAGGTGGAGGG - Intergenic
1036936304 8:13005291-13005313 AAGCGTAGCGGGGAGGTGGGAGG + Intronic
1037208595 8:16356950-16356972 AAGAGTAGTGGGGGAGTGGAAGG - Intronic
1037241481 8:16783820-16783842 CAGTGCAGTGGGGGGCTGAAGGG - Intergenic
1037614069 8:20501624-20501646 CTGATTAGTGGGGAGGTGAATGG - Intergenic
1037716813 8:21407907-21407929 CAGCAGAGTGGGGAGGAGGAAGG - Intergenic
1037796273 8:21997836-21997858 CAGTGTGGTGGGGGGGAGGAAGG + Intronic
1037971410 8:23174248-23174270 CAGTGCAGTGGGGGGGCTGAAGG + Intergenic
1038247351 8:25871164-25871186 CAGGGAAGTAGGGAGGGGGAGGG - Intronic
1038481048 8:27902061-27902083 CAGTGAAATTGGGAGGTGAAGGG - Intronic
1039852274 8:41379378-41379400 GAGTGGAGTGAGGAAGTGGATGG + Intergenic
1040781946 8:51120049-51120071 CAGAGTAGTGGGGGGAAGGATGG - Intergenic
1041110700 8:54479876-54479898 CAGTGTAGTGGGGAGGTGGAAGG + Intergenic
1041918862 8:63161901-63161923 CAGTGCAGTGGGGGGGCTGAAGG - Intergenic
1042099551 8:65260072-65260094 AAGGGTAGTGGGGAGTTGGCGGG - Intergenic
1042186847 8:66144679-66144701 CAGAGAAGAGGGGAGGTGTATGG + Intronic
1043923385 8:86009618-86009640 CAGGGTAGAGGGTAGGAGGAGGG - Intronic
1043951461 8:86314054-86314076 GAGTGTGGTGGATAGGTGGAGGG - Intronic
1046323708 8:112612926-112612948 GAGTGCAGCGGGGAGGGGGATGG + Intronic
1046947703 8:119989452-119989474 CAGTCTAGTGTGGAGGTTCAGGG + Intronic
1047324536 8:123824037-123824059 AAGAGTGGTGGGGAGGTGAAGGG - Intergenic
1047877214 8:129152272-129152294 GACTGTGGTGGGGAGGTGGGAGG - Intergenic
1048766227 8:137847393-137847415 CAGTGTAGTAGGGAGAAGGAAGG - Intergenic
1048802393 8:138206357-138206379 TAGAGTTGTGGGTAGGTGGAGGG - Intronic
1049377753 8:142297054-142297076 CTGTGAAGTGGGCAGGTGGAAGG - Intronic
1049562225 8:143317541-143317563 CAGAGTCCTGGGGAGGAGGAGGG - Intronic
1049976176 9:862503-862525 CCGTGCAATGGGGAGGGGGAGGG + Intronic
1050366295 9:4876831-4876853 CAGTGTAGATGGGAGGTAGAGGG + Intronic
1051222264 9:14861966-14861988 AAGGGTAGTGGGGAGTTGCAGGG - Intronic
1051644987 9:19259238-19259260 AAGGGCAGTGGGGAGGTGGCGGG - Intronic
1052863929 9:33453548-33453570 CATTGGAGTGGGGTGGGGGAGGG + Intergenic
1052985425 9:34483227-34483249 CAGTGCAGTGGGGGGCTGAAGGG + Intronic
1053330903 9:37206312-37206334 GAGAGAAGTGGGGAGGAGGAGGG - Intronic
1054813561 9:69453995-69454017 CAGTGTGGTGGGCAGGAGGATGG - Intronic
1055108225 9:72534385-72534407 AAAAGTGGTGGGGAGGTGGAGGG + Intronic
1056106607 9:83353269-83353291 CACTGCAGTGGGGTGGGGGAGGG + Intronic
1056183872 9:84112384-84112406 AAGGGTAGTGGGCAGGGGGAGGG - Intergenic
1056383265 9:86074806-86074828 CAGTGTGGTGGGGCTATGGAAGG - Intronic
1056772806 9:89492063-89492085 AAGGGCAGTGGGGAAGTGGAGGG - Intronic
1057241047 9:93409572-93409594 AAGTGTAGTGGGGAGGCAGCAGG - Intergenic
1057249886 9:93492658-93492680 CTGCGAAGTGGGGTGGTGGAGGG + Intronic
1057383989 9:94591592-94591614 CAGTGCAGTGGGGGGCTGAAAGG + Intronic
1057628708 9:96701366-96701388 CAGTGCAGTGGGGGGGCTGAAGG + Intergenic
1057884744 9:98821798-98821820 CAGAGGAGTGGGGAGGGGGAAGG - Intronic
1057920886 9:99095656-99095678 CTGTGTAATGGGGAGGGGGAAGG - Intergenic
1058309756 9:103485640-103485662 CAGTGCAGTGGGGAAATGTAGGG + Intergenic
1058379630 9:104363349-104363371 CAGTGTAGTGGCGGGCTGAAGGG + Intergenic
1058559620 9:106212193-106212215 GACTGTGGTGGGGAGGTGGGAGG - Intergenic
1059505965 9:114800120-114800142 AGGTGGAGTGGGGAGGGGGAGGG + Intronic
1059666497 9:116451064-116451086 CAGGGGAGTGGGGAGCTGGCAGG + Intronic
1061090743 9:128424544-128424566 AAGTGTAGTTGGGATGTGGCGGG - Exonic
1061098229 9:128472561-128472583 CAGTGTAGAGAAGAGGTAGAAGG + Intronic
1061183309 9:129037478-129037500 CATTGTGGAGAGGAGGTGGAGGG + Intronic
1061206071 9:129164089-129164111 CAGGGAGGTGGGGAGGTGGCAGG + Intergenic
1186612099 X:11147788-11147810 TAGTGTAGTGGAAATGTGGATGG + Intronic
1187039897 X:15582708-15582730 AAGAGTAGTGGGAAGGTGGCAGG + Intronic
1187304535 X:18083714-18083736 CAGTGCAGTGGGGGGCTGAAGGG - Intergenic
1188024926 X:25198162-25198184 CAGGGTAGTGTGGAGGAGTAGGG + Intergenic
1188625514 X:32279665-32279687 AAGGGTAGTGGGGGGGTTGAGGG + Intronic
1189161819 X:38817156-38817178 CAGTGGGGAGGGGAGGGGGATGG - Intergenic
1189275787 X:39784926-39784948 CAGTTTCCTGGGGATGTGGAGGG - Intergenic
1189364995 X:40381200-40381222 CAGGGTATGGGAGAGGTGGAGGG - Intergenic
1190076720 X:47322416-47322438 CAGTGTGGGAGGGAGGAGGAGGG - Intergenic
1190212078 X:48456950-48456972 GAGTGGTGTGGGGAGGTGGTGGG - Intergenic
1190910173 X:54764408-54764430 GACTGTGGTGGGGAGGGGGAAGG - Intronic
1190943003 X:55061735-55061757 AAGTGTAGTGGTGAAGTGGCAGG - Intergenic
1192251334 X:69416702-69416724 CAGTGCAGTGGGGGGCTGAAGGG - Intergenic
1193290330 X:79765745-79765767 GACTGTGGTGGGGAGGTGGGAGG - Intergenic
1193538234 X:82738653-82738675 CAGTGCAGTGGGGGGCTGAAGGG + Intergenic
1193674065 X:84425808-84425830 AAGGGTAGTGGGGAGGTACAGGG + Intronic
1193755979 X:85408950-85408972 CAGTGGACTGGGTAGGGGGAGGG - Intergenic
1194071667 X:89331479-89331501 CAGTGCAGTGGGGGGCTGAAGGG + Intergenic
1194202395 X:90969598-90969620 AAGGGTAGTGGGAGGGTGGAGGG + Intergenic
1194225123 X:91246838-91246860 AAGTGTAGTGGGGTGGGGGTGGG - Intergenic
1195610822 X:106864166-106864188 CAGTTTAGAGGTGAGGTGGGAGG + Intronic
1195688490 X:107605390-107605412 CTGTGTGTTGGGGAGGTGGGAGG - Intergenic
1195958133 X:110356066-110356088 GAGGTTAGTGGGGAGGAGGAGGG + Intronic
1195979070 X:110558822-110558844 CAGTGTGGGGGGGAGGGGAAGGG + Intergenic
1196073985 X:111554480-111554502 CAGTTTAGTGGCATGGTGGAGGG + Intergenic
1196322675 X:114360700-114360722 AAGGGTAGTGGGAAAGTGGAGGG + Intergenic
1196470880 X:116024951-116024973 AAGGGTAGTGGGGAGCTGGGAGG + Intergenic
1196512156 X:116524322-116524344 CAGTGGACTGGGAAGGTGGGTGG - Intergenic
1196662588 X:118283153-118283175 CAGTGCAGTGGGGGGGCTGAAGG + Intergenic
1196729008 X:118922434-118922456 CAGTGCAGTGGGGGGGCTGAAGG + Intergenic
1197487089 X:127066101-127066123 AAGGGTAGTTGGGAGGGGGAAGG - Intergenic
1198585904 X:138122020-138122042 AAGGGTAGTTGGAAGGTGGAAGG - Intergenic
1198717048 X:139568704-139568726 AAGCGTAGTGGGGGGTTGGAGGG + Intergenic
1199050918 X:143235865-143235887 CAGAGTAGTGGGGGGCTGGTAGG + Intergenic
1199598120 X:149524205-149524227 CAGGGTAGTGGGACGGTGTATGG - Intronic
1199754707 X:150853391-150853413 CAGTGAAGTGGGTGGGTGGGGGG - Intronic
1200149107 X:153942797-153942819 CAGGGGAGTGGGGGAGTGGAAGG + Intronic
1200371711 X:155733010-155733032 AAGTGTAGTGGGGAGAGAGAAGG + Intergenic
1200519765 Y:4195899-4195921 CAGTGCAGTGGTGGGGTGAAGGG + Intergenic
1200561589 Y:4710145-4710167 AAGTGTAGTGGGGTGGGGGTGGG - Intergenic
1200725911 Y:6667208-6667230 CAGTGCAGTGGGGGGCTGAAGGG + Intergenic
1200831850 Y:7693181-7693203 CAGGGCAGTGGGGATGAGGATGG - Intergenic
1201144781 Y:11058233-11058255 GAGTGGAGGGGGGATGTGGATGG + Intergenic
1201243997 Y:11985835-11985857 CAGTGAAGTGGGGATGAGGGAGG + Intergenic