ID: 1041114001

View in Genome Browser
Species Human (GRCh38)
Location 8:54516691-54516713
Sequence CTGTGGGAGGGTAAGGCGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041113992_1041114001 11 Left 1041113992 8:54516657-54516679 CCGGATGTGATGGCTCAATCCTA No data
Right 1041114001 8:54516691-54516713 CTGTGGGAGGGTAAGGCGAGAGG No data
1041113995_1041114001 -8 Left 1041113995 8:54516676-54516698 CCTATAATCCCAGCACTGTGGGA 0: 278
1: 31198
2: 327055
3: 249294
4: 135373
Right 1041114001 8:54516691-54516713 CTGTGGGAGGGTAAGGCGAGAGG No data
1041113989_1041114001 30 Left 1041113989 8:54516638-54516660 CCTCATTAGGTACATGGGACCGG No data
Right 1041114001 8:54516691-54516713 CTGTGGGAGGGTAAGGCGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041114001 Original CRISPR CTGTGGGAGGGTAAGGCGAG AGG Intergenic
No off target data available for this crispr