ID: 1041117237

View in Genome Browser
Species Human (GRCh38)
Location 8:54551790-54551812
Sequence GGGAAGAGGCGAGCTCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041117237_1041117245 21 Left 1041117237 8:54551790-54551812 CCTCCCAGAGCTCGCCTCTTCCC No data
Right 1041117245 8:54551834-54551856 GATGCTCATGCGCCACAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041117237 Original CRISPR GGGAAGAGGCGAGCTCTGGG AGG (reversed) Intergenic
No off target data available for this crispr