ID: 1041117239

View in Genome Browser
Species Human (GRCh38)
Location 8:54551794-54551816
Sequence CAGAGGGAAGAGGCGAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041117239_1041117245 17 Left 1041117239 8:54551794-54551816 CCAGAGCTCGCCTCTTCCCTCTG No data
Right 1041117245 8:54551834-54551856 GATGCTCATGCGCCACAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041117239 Original CRISPR CAGAGGGAAGAGGCGAGCTC TGG (reversed) Intergenic
No off target data available for this crispr