ID: 1041117245

View in Genome Browser
Species Human (GRCh38)
Location 8:54551834-54551856
Sequence GATGCTCATGCGCCACAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041117242_1041117245 0 Left 1041117242 8:54551811-54551833 CCTCTGCAGTCCCGAGCTGCACT No data
Right 1041117245 8:54551834-54551856 GATGCTCATGCGCCACAAGATGG No data
1041117241_1041117245 1 Left 1041117241 8:54551810-54551832 CCCTCTGCAGTCCCGAGCTGCAC No data
Right 1041117245 8:54551834-54551856 GATGCTCATGCGCCACAAGATGG No data
1041117237_1041117245 21 Left 1041117237 8:54551790-54551812 CCTCCCAGAGCTCGCCTCTTCCC No data
Right 1041117245 8:54551834-54551856 GATGCTCATGCGCCACAAGATGG No data
1041117240_1041117245 7 Left 1041117240 8:54551804-54551826 CCTCTTCCCTCTGCAGTCCCGAG No data
Right 1041117245 8:54551834-54551856 GATGCTCATGCGCCACAAGATGG No data
1041117239_1041117245 17 Left 1041117239 8:54551794-54551816 CCAGAGCTCGCCTCTTCCCTCTG No data
Right 1041117245 8:54551834-54551856 GATGCTCATGCGCCACAAGATGG No data
1041117243_1041117245 -10 Left 1041117243 8:54551821-54551843 CCCGAGCTGCACTGATGCTCATG No data
Right 1041117245 8:54551834-54551856 GATGCTCATGCGCCACAAGATGG No data
1041117238_1041117245 18 Left 1041117238 8:54551793-54551815 CCCAGAGCTCGCCTCTTCCCTCT No data
Right 1041117245 8:54551834-54551856 GATGCTCATGCGCCACAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041117245 Original CRISPR GATGCTCATGCGCCACAAGA TGG Intergenic
No off target data available for this crispr