ID: 1041117488

View in Genome Browser
Species Human (GRCh38)
Location 8:54554359-54554381
Sequence CTTCAAATCCCTTTGAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 233}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041117488_1041117494 12 Left 1041117488 8:54554359-54554381 CCCAGCTTCAAAGGGATTTGAAG 0: 1
1: 0
2: 0
3: 17
4: 233
Right 1041117494 8:54554394-54554416 CTCCAGCCCAGACTGCGCCTCGG 0: 1
1: 0
2: 2
3: 34
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041117488 Original CRISPR CTTCAAATCCCTTTGAAGCT GGG (reversed) Intergenic
902060853 1:13641244-13641266 CTTCACATGCCTGTGAGGCTGGG - Intergenic
905625470 1:39487999-39488021 CTCCAAATTCCTTTTAATCTGGG - Intergenic
907106302 1:51885857-51885879 CTTCAGATCACTATGAATCTGGG + Intergenic
907648803 1:56273107-56273129 CTTCACATCCCTTGTAAGTTGGG - Intergenic
911128615 1:94365981-94366003 CTTCACATCCCTTGTAAGTTGGG + Intergenic
911409143 1:97479911-97479933 CTTTAAATTCCCTTGCAGCTGGG + Intronic
911727582 1:101258192-101258214 CTAGAGATCCCTTTGAAGTTTGG + Intergenic
913647481 1:120872571-120872593 CTTCACATCCCTTGTAAGTTGGG + Intergenic
914079158 1:144390289-144390311 CTTCACATCCCTTGTAAGTTGGG - Intergenic
914100021 1:144576213-144576235 CTTCACATCCCTTGTAAGTTGGG + Intergenic
914174062 1:145258836-145258858 CTTCACATCCCTTGTAAGTTGGG - Intergenic
914298967 1:146361469-146361491 CTTCACATCCCTTGTAAGTTGGG - Intergenic
914528724 1:148500021-148500043 CTTCACATCCCTTGTAAGTTGGG - Intergenic
914637670 1:149567087-149567109 CTTCACATCCCTTGTAAGTTGGG + Intergenic
915444768 1:155968327-155968349 CTGTAAATCCCTATGAAACTTGG - Intronic
917067255 1:171110486-171110508 CTTCCATTTACTTTGAAGCTGGG + Intronic
918418301 1:184335678-184335700 CTTCAACTTCCTTAGTAGCTGGG - Intergenic
919845020 1:201636532-201636554 CTTCAGCTCCCTCTGAAGCCTGG - Intronic
919983518 1:202657436-202657458 CTTCAAATGCCTAAGAAGCCAGG - Intronic
922279337 1:224108092-224108114 CTTCAAATCTCTTTTTAGTTAGG + Intergenic
923502376 1:234576298-234576320 CCTCAAATCCCTCTGCAGCCTGG + Intergenic
923509246 1:234635310-234635332 CTTCAAATCCCACTGACACTGGG + Intergenic
1063234744 10:4101770-4101792 TTTAAAATCACTTTGAGGCTGGG - Intergenic
1063337175 10:5227105-5227127 CTTCACATCCCTTGTAAGTTGGG - Intergenic
1064488513 10:15823462-15823484 TTGCAAATCCCTTTAATGCTTGG - Intronic
1067129379 10:43547713-43547735 CTTAAAAGCCCTTTGGAGCCAGG - Intergenic
1068263677 10:54619239-54619261 TTTAAAATCTCTTTGAAGTTAGG - Intronic
1068497608 10:57805291-57805313 CTTCACATCCCTCTTAAGCTTGG + Intergenic
1069035704 10:63643858-63643880 CTTAAAATCCCTCTGTAGGTGGG - Intergenic
1071090277 10:81910332-81910354 CCCCAAATCCCTTTGACGGTGGG + Intronic
1071769177 10:88705485-88705507 CTTCAGATTACTTTGAAGCATGG + Intergenic
1072778852 10:98229295-98229317 CTTCACATCCCTTGTAAGTTGGG + Intronic
1073032654 10:100539755-100539777 TTTCACATCCCCTTGAAGCCAGG - Intronic
1074194405 10:111168679-111168701 CTTCACATCCCTTATAAGTTGGG + Intergenic
1074241250 10:111641509-111641531 CTTCACATCCCTTGTAAGTTGGG - Intergenic
1075391306 10:122094582-122094604 CTCTAAATCCCTTTGAAAGTGGG + Intronic
1075698653 10:124454044-124454066 CTTTAAATTGCTTTGATGCTAGG + Intergenic
1078578464 11:12520535-12520557 CTTGAAATCCCCTAGAAACTGGG + Intronic
1079271477 11:18990424-18990446 CTTCACATCCCTTGTAAGTTGGG + Intergenic
1080909046 11:36576415-36576437 CTTAAAATTCCATTGAATCTTGG - Exonic
1081769845 11:45643200-45643222 CTTCAAAGCTCTGTGACGCTTGG + Intergenic
1082230838 11:49763982-49764004 CTTCACATCCCTTGTAAGCCTGG + Intergenic
1083750884 11:64759982-64760004 CTTTAAATCCCCTTGAGGCTGGG - Exonic
1085061670 11:73453056-73453078 CTTCAAATACATTTTAACCTTGG + Intronic
1086903028 11:92388932-92388954 CTTCAAATGCATTTGTTGCTTGG + Intronic
1088181419 11:107116938-107116960 CTTGAAATGCCATTGAAGCTAGG - Intergenic
1091441645 12:515490-515512 CATAAAAACCCTTTGAGGCTGGG - Intronic
1092261197 12:6954106-6954128 CTTCAAATCCGTTTGAACCCTGG + Intronic
1093463940 12:19431300-19431322 CATCAAATCCCTGGGAAGGTAGG - Intronic
1096492128 12:52018737-52018759 CTGAAAATCCCTTTGGGGCTGGG + Intergenic
1097312665 12:58137706-58137728 CTTCACTTCCCTTTTTAGCTGGG + Intergenic
1097394735 12:59060005-59060027 CTTCAATCCTCTGTGAAGCTGGG - Intergenic
1098003008 12:65965144-65965166 CTTCAAGTTTCTTTGAAGGTTGG - Exonic
1099780755 12:87192600-87192622 CTTCACATCCCTTGTAAGTTGGG - Intergenic
1100766346 12:97869979-97870001 CTTCACATCCCTTGTAAGTTGGG - Intergenic
1101174851 12:102139198-102139220 CTTCACATCCCTTGTAAGTTGGG + Intronic
1101188777 12:102309472-102309494 CTTCACATCCCTTGTAAGTTGGG + Intergenic
1101579722 12:106031932-106031954 CCTCAAGTCCCTTGGCAGCTGGG + Intergenic
1102598954 12:114014167-114014189 CTCCAAATCCCTTTCAACGTGGG - Intergenic
1104120636 12:125795839-125795861 CCTCTAATCCCTTTGTATCTAGG - Intergenic
1105317263 13:19277283-19277305 CTTCACATCCCTTCTAAGTTGGG - Intergenic
1106892249 13:34258250-34258272 CATCTTATCCCTTTGAATCTGGG - Intergenic
1107734419 13:43383120-43383142 CTTCAAAACCCTTTGAGGTCTGG - Intronic
1109220348 13:59635293-59635315 CTCCTGATCCATTTGAAGCTGGG - Intergenic
1110320131 13:74151787-74151809 CTTCAAATCACATTGCAGATAGG - Intergenic
1112808148 13:103185798-103185820 CTTCAACTCCTGTGGAAGCTAGG - Intergenic
1113553431 13:111211778-111211800 CCTAACATTCCTTTGAAGCTGGG + Intronic
1114004219 14:18294538-18294560 CTTCACATCCCTTGTAAGTTGGG + Intergenic
1115521165 14:34234360-34234382 CTTCCAAGCCCTATGAATCTGGG - Intronic
1115974751 14:38984512-38984534 CTTCACATCCCTTTGACTCTTGG + Intergenic
1117303887 14:54454179-54454201 ATTCAAATTCCTGTGAGGCTTGG + Intergenic
1118433412 14:65746154-65746176 TCTCAACTCCCTTAGAAGCTGGG - Intergenic
1119085579 14:71736098-71736120 CCTTAAAACCCTTTGAGGCTGGG + Intronic
1120045527 14:79801665-79801687 CTTCAAACTCCTTTGAGTCTGGG + Intronic
1124572962 15:30883021-30883043 AGTAAAATCTCTTTGAAGCTTGG - Intergenic
1126084097 15:44994808-44994830 CTTCACATCCCTTGTAAGTTGGG - Intergenic
1128961950 15:72015513-72015535 GGTCAAATCCCTTTGCAGCATGG + Intronic
1129963642 15:79713373-79713395 CTTCACATCCCTTGTAAGTTGGG - Intergenic
1132326157 15:100972256-100972278 TTTAAAATCCTTTTGAGGCTGGG - Intronic
1133425223 16:5682564-5682586 CTTTAAATCCTTGTGAACCTGGG + Intergenic
1139240394 16:65385683-65385705 ATTCAAAACCTTTTGAGGCTTGG - Intergenic
1139793724 16:69464087-69464109 CATCAAATCCCTGGCAAGCTGGG - Exonic
1140020978 16:71238341-71238363 CATCAAATCTCTTCAAAGCTAGG + Intergenic
1140498799 16:75414545-75414567 CTTCAAGGCCCTTAGAAGTTAGG - Intronic
1141205348 16:81929113-81929135 CTTCACATCCCGTTGCAGCATGG - Intronic
1143850431 17:9807538-9807560 TTTCAAATCACTGTGAACCTTGG - Exonic
1145126790 17:20307548-20307570 CCTCAAATGCCCTTGCAGCTGGG - Intronic
1146671264 17:34739646-34739668 TTTCAGTTCCCTTTGACGCTGGG - Intergenic
1147265658 17:39232766-39232788 CTTTAAATCCCTCTCAAGTTTGG - Intergenic
1151985404 17:77540201-77540223 CTTTAAACACCTTTGAGGCTGGG - Intergenic
1153359367 18:4176137-4176159 CTTCACATCCCTTGCTAGCTTGG + Intronic
1156384071 18:36590300-36590322 AGTCAAAACCCTTGGAAGCTTGG - Intronic
1157981795 18:52390258-52390280 CTGCATATCCCTTTGGAGGTAGG + Intronic
1158666387 18:59436586-59436608 CTACAAAACCCTATGAAGTTGGG - Intronic
1159776843 18:72612469-72612491 CTTCAAAGCCCTTTGCAGAATGG + Intronic
1160438365 18:78868438-78868460 CTTCAAAGGGCTTCGAAGCTGGG + Intergenic
1164210701 19:23095072-23095094 CATCAAATCCCTCTGGTGCTGGG - Intronic
1164762089 19:30735860-30735882 CCTCAAATCCCTTTGGAAATAGG + Intergenic
1164770742 19:30806932-30806954 CTTCAACTGCCTTTGCAGCCAGG + Intergenic
1166240686 19:41490790-41490812 CTTCACATCCCTTGTAAGTTGGG - Intergenic
1166600421 19:44089240-44089262 CTTCAATCCCCTGAGAAGCTGGG + Exonic
1167147075 19:47688123-47688145 CTCGAAATCTCTTGGAAGCTGGG + Intronic
926925665 2:17984847-17984869 CTTCACATCCCTTGTAAGTTGGG + Intronic
926928609 2:18013734-18013756 CTTCACATCCCTTGTAAGTTGGG + Intronic
930918783 2:56725609-56725631 CTTCACATCCCTTGTAAGTTGGG + Intergenic
931173680 2:59831316-59831338 CATAAATTCCCTGTGAAGCTTGG - Intergenic
932952411 2:76309563-76309585 TTTCAAATCTCTTTGATACTGGG - Intergenic
933196653 2:79397894-79397916 CTTCATTTCCCTTTGAATCTAGG + Intronic
933268888 2:80211927-80211949 CTTCATATCCCTTGTAAGTTGGG + Intronic
935093058 2:99915517-99915539 GTTCAAATCCCTTTGGAGCCAGG + Intronic
935321448 2:101893398-101893420 CCTCAAATCCCTTTAAAGGTAGG - Intronic
936078915 2:109419003-109419025 CTTAAAAAACCCTTGAAGCTTGG + Intronic
936079191 2:109420791-109420813 CTTCTAGACCTTTTGAAGCTTGG - Intronic
938791642 2:134681435-134681457 CTTCAAAGGCCTTTGCATCTGGG - Intronic
943693413 2:190893878-190893900 CTAAAAATGCATTTGAAGCTGGG - Intronic
944642599 2:201743414-201743436 CTTCCAACCTCTTTGTAGCTGGG + Intronic
944718151 2:202395972-202395994 CTTACAATTCCTTTGAGGCTGGG + Intronic
944920829 2:204411443-204411465 CTTCACCTCCATTTGCAGCTAGG - Intergenic
945676375 2:212859987-212860009 CTTCACATCCCTTGTAAGTTGGG - Intergenic
945842275 2:214901918-214901940 CTTTAAATTTCTTTGCAGCTAGG - Intergenic
946962098 2:224996317-224996339 CTACAAGTCCCCTTGAAGTTTGG - Intronic
948971663 2:241432811-241432833 CTTCAAACCCCATGGTAGCTTGG - Intronic
1171064558 20:22001765-22001787 CTTTATTTCTCTTTGAAGCTGGG - Intergenic
1171218590 20:23372845-23372867 CTGCACATCCCTTTGGAGTTTGG - Exonic
1172455566 20:35069823-35069845 CTTCAAATTCCTGAGTAGCTGGG - Intronic
1173015590 20:39222525-39222547 TTTCTAATCCCTTTGAACATGGG - Intergenic
1173859577 20:46274073-46274095 ATTAAAATTCCTTTGAAACTAGG - Intronic
1174319710 20:49731665-49731687 CCTCAGACTCCTTTGAAGCTGGG - Intergenic
1175369328 20:58476728-58476750 CCTCGAAGCCCTTTGAAACTGGG + Intronic
1175819768 20:61902473-61902495 CTGCAAATCCCTGGGAAGGTGGG - Intronic
1177272866 21:18871787-18871809 CTTCACATCCCTTGTAAGTTGGG + Intergenic
1177398138 21:20563786-20563808 ATTCTACTCCCTTTGAATCTGGG - Intergenic
1177669416 21:24206997-24207019 CTTGAAATGCCTTGTAAGCTGGG + Intergenic
1180428734 22:15225337-15225359 CTTCACATCCCTTGTAAGTTGGG + Intergenic
1180640543 22:17295010-17295032 CTTCACATCCCTTGTAAGTTGGG + Intergenic
949156866 3:838214-838236 GTTCAAAACCCTCAGAAGCTGGG + Intergenic
951610669 3:24489679-24489701 CTTCAAAGTCCTTTGAAATTAGG + Intronic
952173600 3:30836625-30836647 CTTCACTTCCCTTTCAAGATTGG - Intronic
952275020 3:31868401-31868423 CTTCAAAACCCGATGGAGCTCGG - Intronic
952609806 3:35194732-35194754 CTTCAGATTCCTTGGAAGTTCGG - Intergenic
953775592 3:45814157-45814179 CTTCATGTCCCTTTGCAGCCAGG - Intergenic
955527182 3:59833188-59833210 CAACATATCCATTTGAAGCTGGG - Intronic
956513516 3:70020555-70020577 CTTCCCATCCCTGTGCAGCTTGG + Intergenic
958192660 3:90203211-90203233 TTAAGAATCCCTTTGAAGCTGGG + Intergenic
959139985 3:102473933-102473955 CTTCAAAGCTCTCTGATGCTTGG + Intronic
959546396 3:107601884-107601906 CTTTGAAGCTCTTTGAAGCTAGG - Intronic
960425862 3:117507205-117507227 CTTCACATTCCTATAAAGCTAGG - Intergenic
961335829 3:126179291-126179313 CTTCTAGTCCCTGTGAGGCTGGG + Intronic
962062284 3:131942742-131942764 CTTCGAATCCCTCTAAAGCAAGG + Intronic
962123703 3:132591485-132591507 CTTCTAATTCCTTTGAACCCTGG + Intronic
962233325 3:133685633-133685655 CTTCACATCCCTTGTAAGTTGGG - Intergenic
963064997 3:141256603-141256625 CTTCAAATCCATGTGAATTTTGG + Intronic
964078687 3:152724182-152724204 CTTTAAGTCCCTAAGAAGCTAGG - Intergenic
965521700 3:169674638-169674660 CTTCAACCCCCTGTGTAGCTGGG + Intergenic
965899006 3:173615780-173615802 ATACAAATCTCTTTAAAGCTGGG + Intronic
966377731 3:179314089-179314111 CTTCAAATGCCACAGAAGCTGGG + Intergenic
966820969 3:183924132-183924154 CCTCAAATTCCTTAGTAGCTGGG + Intronic
967364694 3:188672678-188672700 CTTCCTATACCTTTGAAGATTGG + Intronic
967426260 3:189330762-189330784 TTTCAGATTCCTTTGTAGCTAGG - Intergenic
967545108 3:190716474-190716496 TTTGAAAACCATTTGAAGCTTGG - Intergenic
969067587 4:4500044-4500066 CTAAAAATCCCATTGAAGATAGG - Intronic
970353264 4:15227473-15227495 CTTCAAATCCCTTCAGAGATGGG + Intergenic
970461011 4:16275017-16275039 ATTCAAAGCAGTTTGAAGCTGGG + Intergenic
971673238 4:29591553-29591575 CTTCAAATACCTTTTCATCTTGG - Intergenic
971695794 4:29901367-29901389 TTTCCAGTCCCTTTGAATCTAGG + Intergenic
972837655 4:42893265-42893287 CTTCATCTCCCTTTTAAGCATGG - Exonic
974497593 4:62652381-62652403 CTTCAAATCCATTTCAAGGAAGG + Intergenic
975156045 4:71074216-71074238 CTTCAAATCCCAGTGAGTCTGGG + Intergenic
976086671 4:81413865-81413887 CTTCCATCCCCTTTGAAGTTAGG - Intergenic
977962070 4:103097713-103097735 CTTCCAACCTCTTTGCAGCTAGG - Intronic
978057754 4:104293527-104293549 CTGCAGATCACTATGAAGCTAGG - Intergenic
981722337 4:147814305-147814327 CTTCAAATAAATTTAAAGCTTGG - Intronic
983029594 4:162783208-162783230 CAACAAATTCCTTTGAAGTTTGG - Intergenic
983201206 4:164862265-164862287 CTTCACATCCCTTGTAAGTTGGG - Intergenic
983543697 4:168939719-168939741 CTTCACATCCCTTGTAAGTTGGG - Intronic
984340121 4:178446517-178446539 CTTCACATCCCTTGTAAGTTGGG + Intergenic
984966497 4:185144381-185144403 ATCCAAAGCCCTTTGAAGCAGGG + Intronic
985062847 4:186095467-186095489 CTTCAAGACCCTTCGCAGCTGGG + Intergenic
985366981 4:189241711-189241733 CTTCACATCCCTTGTAAGTTGGG + Intergenic
987504739 5:18753488-18753510 CTTCAAGGCTCTTTGAAGTTAGG - Intergenic
988840548 5:35079488-35079510 CTTCACATCCCTTGTAAGTTGGG - Intronic
989897016 5:47103320-47103342 CTTCACATCCCTTGTAAGTTGGG + Intergenic
991444360 5:66683512-66683534 CTTCAAGGCCTTTTCAAGCTAGG + Intronic
995476523 5:112553806-112553828 CTTCAAAGCCCTTTTCAGCTGGG + Intergenic
995995555 5:118293889-118293911 CTTCAACTCCTTTTGAGACTTGG - Intergenic
998399794 5:141842796-141842818 CCCCAAAGCCCTGTGAAGCTTGG - Intergenic
999042120 5:148426137-148426159 CCTCACATCCCTTTAAATCTAGG + Intronic
1000241562 5:159413307-159413329 ATTCAAACCACATTGAAGCTGGG + Intergenic
1000411949 5:160942792-160942814 CTTCACATCCCTTGTAAGTTGGG + Intergenic
1000542256 5:162554486-162554508 CTTCACATCCCTTGTAAGTTGGG + Intergenic
1001889291 5:175325839-175325861 CATCAAATTCCTTTGAAACTAGG + Intergenic
1004977654 6:20985622-20985644 CTTAAAATAACTTTAAAGCTAGG + Intronic
1005115042 6:22326871-22326893 CCTCTCATCCCTTTGGAGCTGGG - Intergenic
1006318997 6:33308434-33308456 GTTCAAATACCTTGAAAGCTGGG - Intronic
1006913173 6:37577444-37577466 CTACAAAGCCCCCTGAAGCTGGG + Intergenic
1009050851 6:58274709-58274731 CTTCAAATCTTTATGAAGTTTGG + Intergenic
1009053770 6:58311461-58311483 CTTCACATCCCTTGTAAGTTGGG + Intergenic
1009239573 6:61167674-61167696 CTTCAAATCTTTATGAAGTTTGG - Intergenic
1010321582 6:74516309-74516331 CTTCACATCCCTTGTAAGTTGGG - Intergenic
1012340445 6:98115881-98115903 CTTCTTTTCCCTGTGAAGCTTGG + Intergenic
1016655939 6:146518413-146518435 CTTCAAATACATTTGAGGATTGG + Intergenic
1021069991 7:16225264-16225286 CTTAAAATACTTTTGAAGTTAGG - Intronic
1021320375 7:19202894-19202916 CTTCAAATCCCTTTGCACTTAGG + Intergenic
1024172696 7:46806831-46806853 CTCCATATCCCTTAGCAGCTTGG + Intergenic
1025833336 7:65073925-65073947 CTTGAAACTCATTTGAAGCTTGG - Intergenic
1025903099 7:65763426-65763448 CTTGAAACTCATTTGAAGCTTGG - Intergenic
1026326543 7:69315395-69315417 CTTCCTAGCCCTTTGAATCTTGG - Intergenic
1027712925 7:81630672-81630694 GTTCACATCCCTTTCAATCTAGG + Intergenic
1027716116 7:81672745-81672767 CTTCAAACCACTTAGAAGCAGGG - Intergenic
1028002709 7:85520430-85520452 CTTCAAATCCCCTTACAACTTGG - Intergenic
1028355217 7:89898610-89898632 CTTCACATCCCTTGTAAGCTAGG + Intergenic
1028821489 7:95216676-95216698 CTTCACATCCCTTGTAAGTTGGG + Intronic
1030367739 7:108665041-108665063 CTTCCAATCCCCTTGAAGTTAGG + Intergenic
1033376312 7:140764729-140764751 CTTCACATCCCTTGTAAGTTGGG - Intronic
1034042836 7:147897602-147897624 CATGAAATGCCTTTGAGGCTGGG - Intronic
1034703509 7:153118738-153118760 CTTCACATCCCTTGTAAGTTGGG + Intergenic
1038473068 8:27841883-27841905 TTTTAATTCTCTTTGAAGCTAGG + Intergenic
1040009559 8:42649992-42650014 GTGCAAATCCCTTGGGAGCTTGG - Intergenic
1040840921 8:51783479-51783501 GTTCACATCCCTTTAAAACTTGG + Intronic
1041084358 8:54243211-54243233 CTTCAAAGCCCTTTTCAGCCTGG - Intergenic
1041117488 8:54554359-54554381 CTTCAAATCCCTTTGAAGCTGGG - Intergenic
1041976459 8:63804378-63804400 CTTCAAGGCCCTTTTAAGTTGGG + Intergenic
1043922381 8:85998141-85998163 CTTCAAATCATTTTGGAGCTGGG + Intronic
1046950780 8:120017838-120017860 CTTGAAATCCCTCTGAGACTTGG - Intronic
1047744452 8:127833779-127833801 CTTCATATCCCTCTGGAGCCAGG - Intergenic
1048179670 8:132183505-132183527 CTTCAAATCCATGGGAAGGTTGG - Intronic
1049689171 8:143951264-143951286 CTTCAGATCCTTGTGAAGCCGGG - Intronic
1051422535 9:16903085-16903107 CTTCAAAGTGATTTGAAGCTGGG - Intergenic
1051489256 9:17643098-17643120 CTTCACATCCCTTGTAAGTTGGG + Intronic
1051708685 9:19907765-19907787 CTTCAAATCCCTTGTAAGTTGGG - Intergenic
1051811687 9:21056683-21056705 CTTCAAGCCTCTGTGAAGCTTGG - Intergenic
1052526184 9:29622512-29622534 CTTAAAATCTCATTGAGGCTAGG + Intergenic
1053335508 9:37267086-37267108 CTTCCAAAGCCTTTGAAACTGGG - Intronic
1053395157 9:37766788-37766810 CTTCACATCCCTTGTAAGCTGGG + Intronic
1056191878 9:84192717-84192739 CTTCAAATCTCTTTGTAGACAGG - Intergenic
1059979809 9:119759230-119759252 CTTCAGAGCCCATTGAAGCAGGG + Intergenic
1203420454 Un_KI270373v1:1373-1395 CTTCACATCCCTTTGTAGGTTGG + Intergenic
1187602720 X:20849895-20849917 CTTCACATCCCTTGTAAGTTGGG - Intergenic
1189063946 X:37785988-37786010 CTTCAAATCGCAGAGAAGCTTGG + Intronic
1191865679 X:65701917-65701939 CCTCAAATCCCTCTGCACCTTGG - Intronic
1194017160 X:88637138-88637160 CATGAACTCCCTTTGAACCTTGG - Intergenic
1194475468 X:94354039-94354061 GTTAAAAACCCATTGAAGCTGGG + Intergenic
1196177884 X:112660368-112660390 TTTTAAATCCCTCTGAAGATAGG + Intronic
1196625801 X:117875708-117875730 CTTCACATCCCTTGTAAGTTGGG + Intergenic
1197423613 X:126268257-126268279 CTTCACATCCCTTGTAAGTTGGG + Intergenic
1197915388 X:131528898-131528920 CTTCACATCCCTTGTAAGTTGGG - Intergenic
1197957241 X:131964879-131964901 CTTCACATCCCTTGTAAGTTGGG - Intergenic
1197987847 X:132286182-132286204 CTTCACATCCCTTGTAAGTTGGG + Intergenic
1198044055 X:132882335-132882357 CTTCACATCCCTTGTAAGTTGGG + Intronic
1199036629 X:143058353-143058375 TTTCATTTCCCTGTGAAGCTAGG - Intergenic
1201903079 Y:19063187-19063209 CTTAAAAATCCTTTGAGGCTGGG - Intergenic