ID: 1041119820

View in Genome Browser
Species Human (GRCh38)
Location 8:54574782-54574804
Sequence CTAGTTCTGTAATCTGTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041119818_1041119820 29 Left 1041119818 8:54574730-54574752 CCAGAGTTAACTTAAAAATGAAC No data
Right 1041119820 8:54574782-54574804 CTAGTTCTGTAATCTGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041119820 Original CRISPR CTAGTTCTGTAATCTGTGTT GGG Intergenic
No off target data available for this crispr