ID: 1041131920

View in Genome Browser
Species Human (GRCh38)
Location 8:54710427-54710449
Sequence ACACTGCTGTCTACAGACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041131920_1041131924 15 Left 1041131920 8:54710427-54710449 CCACCGTCTGTAGACAGCAGTGT No data
Right 1041131924 8:54710465-54710487 GGCCCTTTGCCTCGTTGTGTAGG No data
1041131920_1041131922 -7 Left 1041131920 8:54710427-54710449 CCACCGTCTGTAGACAGCAGTGT No data
Right 1041131922 8:54710443-54710465 GCAGTGTGTTATCAGTTCTGTGG No data
1041131920_1041131925 16 Left 1041131920 8:54710427-54710449 CCACCGTCTGTAGACAGCAGTGT No data
Right 1041131925 8:54710466-54710488 GCCCTTTGCCTCGTTGTGTAGGG No data
1041131920_1041131923 -6 Left 1041131920 8:54710427-54710449 CCACCGTCTGTAGACAGCAGTGT No data
Right 1041131923 8:54710444-54710466 CAGTGTGTTATCAGTTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041131920 Original CRISPR ACACTGCTGTCTACAGACGG TGG (reversed) Intergenic
No off target data available for this crispr