ID: 1041136501

View in Genome Browser
Species Human (GRCh38)
Location 8:54764602-54764624
Sequence ATAAGACATCAGCCCAACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041136501_1041136503 16 Left 1041136501 8:54764602-54764624 CCAAGGTTGGGCTGATGTCTTAT No data
Right 1041136503 8:54764641-54764663 CCTATCGTTTCTGAAATAGAAGG No data
1041136501_1041136504 17 Left 1041136501 8:54764602-54764624 CCAAGGTTGGGCTGATGTCTTAT No data
Right 1041136504 8:54764642-54764664 CTATCGTTTCTGAAATAGAAGGG No data
1041136501_1041136505 24 Left 1041136501 8:54764602-54764624 CCAAGGTTGGGCTGATGTCTTAT No data
Right 1041136505 8:54764649-54764671 TTCTGAAATAGAAGGGAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041136501 Original CRISPR ATAAGACATCAGCCCAACCT TGG (reversed) Intergenic
No off target data available for this crispr