ID: 1041143132

View in Genome Browser
Species Human (GRCh38)
Location 8:54843798-54843820
Sequence GCTCAGGTGCAGAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041143123_1041143132 17 Left 1041143123 8:54843758-54843780 CCTGCAGGGGCTGGTAGCCATCC No data
Right 1041143132 8:54843798-54843820 GCTCAGGTGCAGAGGGAAGCAGG No data
1041143128_1041143132 -5 Left 1041143128 8:54843780-54843802 CCTGCACAGCATCGCAGGGCTCA No data
Right 1041143132 8:54843798-54843820 GCTCAGGTGCAGAGGGAAGCAGG No data
1041143122_1041143132 22 Left 1041143122 8:54843753-54843775 CCAGTCCTGCAGGGGCTGGTAGC No data
Right 1041143132 8:54843798-54843820 GCTCAGGTGCAGAGGGAAGCAGG No data
1041143127_1041143132 -4 Left 1041143127 8:54843779-54843801 CCCTGCACAGCATCGCAGGGCTC No data
Right 1041143132 8:54843798-54843820 GCTCAGGTGCAGAGGGAAGCAGG No data
1041143118_1041143132 30 Left 1041143118 8:54843745-54843767 CCCTTGCTCCAGTCCTGCAGGGG No data
Right 1041143132 8:54843798-54843820 GCTCAGGTGCAGAGGGAAGCAGG No data
1041143124_1041143132 0 Left 1041143124 8:54843775-54843797 CCATCCCTGCACAGCATCGCAGG No data
Right 1041143132 8:54843798-54843820 GCTCAGGTGCAGAGGGAAGCAGG No data
1041143120_1041143132 29 Left 1041143120 8:54843746-54843768 CCTTGCTCCAGTCCTGCAGGGGC No data
Right 1041143132 8:54843798-54843820 GCTCAGGTGCAGAGGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041143132 Original CRISPR GCTCAGGTGCAGAGGGAAGC AGG Intergenic
No off target data available for this crispr