ID: 1041144786

View in Genome Browser
Species Human (GRCh38)
Location 8:54862570-54862592
Sequence TTGCGGCTGTTACCTGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041144786_1041144788 7 Left 1041144786 8:54862570-54862592 CCACACACAGGTAACAGCCGCAA No data
Right 1041144788 8:54862600-54862622 GCCATTCCCAGCCAGCCATCAGG No data
1041144786_1041144790 8 Left 1041144786 8:54862570-54862592 CCACACACAGGTAACAGCCGCAA No data
Right 1041144790 8:54862601-54862623 CCATTCCCAGCCAGCCATCAGGG No data
1041144786_1041144793 14 Left 1041144786 8:54862570-54862592 CCACACACAGGTAACAGCCGCAA No data
Right 1041144793 8:54862607-54862629 CCAGCCAGCCATCAGGGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041144786 Original CRISPR TTGCGGCTGTTACCTGTGTG TGG (reversed) Intergenic
No off target data available for this crispr