ID: 1041144790

View in Genome Browser
Species Human (GRCh38)
Location 8:54862601-54862623
Sequence CCATTCCCAGCCAGCCATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041144787_1041144790 -9 Left 1041144787 8:54862587-54862609 CCGCAAAGAGAGAGCCATTCCCA No data
Right 1041144790 8:54862601-54862623 CCATTCCCAGCCAGCCATCAGGG No data
1041144786_1041144790 8 Left 1041144786 8:54862570-54862592 CCACACACAGGTAACAGCCGCAA No data
Right 1041144790 8:54862601-54862623 CCATTCCCAGCCAGCCATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041144790 Original CRISPR CCATTCCCAGCCAGCCATCA GGG Intergenic
No off target data available for this crispr