ID: 1041144821

View in Genome Browser
Species Human (GRCh38)
Location 8:54862844-54862866
Sequence TGGCATTTCTGCAATGCGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041144821_1041144825 6 Left 1041144821 8:54862844-54862866 CCTCTCGCATTGCAGAAATGCCA No data
Right 1041144825 8:54862873-54862895 GGAGAGCAACTAGCAGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041144821 Original CRISPR TGGCATTTCTGCAATGCGAG AGG (reversed) Intergenic
No off target data available for this crispr