ID: 1041152127

View in Genome Browser
Species Human (GRCh38)
Location 8:54945329-54945351
Sequence CTTGATGAAGAAATGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041152127_1041152132 25 Left 1041152127 8:54945329-54945351 CCCTTCTCCATTTCTTCATCAAG No data
Right 1041152132 8:54945377-54945399 TGAACCTGGTCTTGTTCTATTGG No data
1041152127_1041152131 11 Left 1041152127 8:54945329-54945351 CCCTTCTCCATTTCTTCATCAAG No data
Right 1041152131 8:54945363-54945385 CTGCTCTGCTTTGCTGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041152127 Original CRISPR CTTGATGAAGAAATGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr