ID: 1041152132

View in Genome Browser
Species Human (GRCh38)
Location 8:54945377-54945399
Sequence TGAACCTGGTCTTGTTCTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041152126_1041152132 26 Left 1041152126 8:54945328-54945350 CCCCTTCTCCATTTCTTCATCAA No data
Right 1041152132 8:54945377-54945399 TGAACCTGGTCTTGTTCTATTGG No data
1041152128_1041152132 24 Left 1041152128 8:54945330-54945352 CCTTCTCCATTTCTTCATCAAGG No data
Right 1041152132 8:54945377-54945399 TGAACCTGGTCTTGTTCTATTGG No data
1041152127_1041152132 25 Left 1041152127 8:54945329-54945351 CCCTTCTCCATTTCTTCATCAAG No data
Right 1041152132 8:54945377-54945399 TGAACCTGGTCTTGTTCTATTGG No data
1041152130_1041152132 18 Left 1041152130 8:54945336-54945358 CCATTTCTTCATCAAGGAATTGA No data
Right 1041152132 8:54945377-54945399 TGAACCTGGTCTTGTTCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041152132 Original CRISPR TGAACCTGGTCTTGTTCTAT TGG Intergenic
No off target data available for this crispr