ID: 1041152132 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:54945377-54945399 |
| Sequence | TGAACCTGGTCTTGTTCTAT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1041152126_1041152132 | 26 | Left | 1041152126 | 8:54945328-54945350 | CCCCTTCTCCATTTCTTCATCAA | No data | ||
| Right | 1041152132 | 8:54945377-54945399 | TGAACCTGGTCTTGTTCTATTGG | No data | ||||
| 1041152128_1041152132 | 24 | Left | 1041152128 | 8:54945330-54945352 | CCTTCTCCATTTCTTCATCAAGG | No data | ||
| Right | 1041152132 | 8:54945377-54945399 | TGAACCTGGTCTTGTTCTATTGG | No data | ||||
| 1041152127_1041152132 | 25 | Left | 1041152127 | 8:54945329-54945351 | CCCTTCTCCATTTCTTCATCAAG | No data | ||
| Right | 1041152132 | 8:54945377-54945399 | TGAACCTGGTCTTGTTCTATTGG | No data | ||||
| 1041152130_1041152132 | 18 | Left | 1041152130 | 8:54945336-54945358 | CCATTTCTTCATCAAGGAATTGA | No data | ||
| Right | 1041152132 | 8:54945377-54945399 | TGAACCTGGTCTTGTTCTATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1041152132 | Original CRISPR | TGAACCTGGTCTTGTTCTAT TGG | Intergenic | ||
| No off target data available for this crispr | |||||