ID: 1041152139 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:54945422-54945444 |
Sequence | CAAGCGACTCCCCTGAAGGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1041152133_1041152139 | 18 | Left | 1041152133 | 8:54945381-54945403 | CCTGGTCTTGTTCTATTGGTGTG | No data | ||
Right | 1041152139 | 8:54945422-54945444 | CAAGCGACTCCCCTGAAGGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1041152139 | Original CRISPR | CAAGCGACTCCCCTGAAGGG TGG | Intergenic | ||