ID: 1041152139

View in Genome Browser
Species Human (GRCh38)
Location 8:54945422-54945444
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041152133_1041152139 18 Left 1041152133 8:54945381-54945403 CCTGGTCTTGTTCTATTGGTGTG No data
Right 1041152139 8:54945422-54945444 CAAGCGACTCCCCTGAAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041152139 Original CRISPR CAAGCGACTCCCCTGAAGGG TGG Intergenic