ID: 1041153290

View in Genome Browser
Species Human (GRCh38)
Location 8:54958060-54958082
Sequence CTCTTGAAGGGAAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041153290_1041153298 14 Left 1041153290 8:54958060-54958082 CCATCCTCCTTTCCCTTCAAGAG No data
Right 1041153298 8:54958097-54958119 AGCCAGATAAAATGTCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041153290 Original CRISPR CTCTTGAAGGGAAAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr