ID: 1041157680

View in Genome Browser
Species Human (GRCh38)
Location 8:55004976-55004998
Sequence CTTTTTCCCAACACTGCGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041157678_1041157680 3 Left 1041157678 8:55004950-55004972 CCAACAAATTCTTAATTAGGGCT No data
Right 1041157680 8:55004976-55004998 CTTTTTCCCAACACTGCGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041157680 Original CRISPR CTTTTTCCCAACACTGCGTT AGG Intergenic
No off target data available for this crispr