ID: 1041158926

View in Genome Browser
Species Human (GRCh38)
Location 8:55017697-55017719
Sequence TTTCAATCAAGTATTTATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041158926_1041158929 15 Left 1041158926 8:55017697-55017719 CCCAGATAAATACTTGATTGAAA No data
Right 1041158929 8:55017735-55017757 TTTCCTTTTTCTGGATTTTTTGG No data
1041158926_1041158928 6 Left 1041158926 8:55017697-55017719 CCCAGATAAATACTTGATTGAAA No data
Right 1041158928 8:55017726-55017748 GAAAATGTATTTCCTTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041158926 Original CRISPR TTTCAATCAAGTATTTATCT GGG (reversed) Intergenic
No off target data available for this crispr