ID: 1041159659

View in Genome Browser
Species Human (GRCh38)
Location 8:55026575-55026597
Sequence GCTTAAGAACACCCTGTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041159659_1041159662 -5 Left 1041159659 8:55026575-55026597 CCACCTACAGGGTGTTCTTAAGC No data
Right 1041159662 8:55026593-55026615 TAAGCAGGCAACTCCACCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041159659 Original CRISPR GCTTAAGAACACCCTGTAGG TGG (reversed) Intergenic