ID: 1041159660 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:55026578-55026600 |
| Sequence | CCTGCTTAAGAACACCCTGT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1041159660_1041159662 | -8 | Left | 1041159660 | 8:55026578-55026600 | CCTACAGGGTGTTCTTAAGCAGG | No data | ||
| Right | 1041159662 | 8:55026593-55026615 | TAAGCAGGCAACTCCACCATAGG | 0: 1 1: 0 2: 0 3: 5 4: 70 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1041159660 | Original CRISPR | CCTGCTTAAGAACACCCTGT AGG (reversed) | Intergenic | ||