ID: 1041159662

View in Genome Browser
Species Human (GRCh38)
Location 8:55026593-55026615
Sequence TAAGCAGGCAACTCCACCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041159659_1041159662 -5 Left 1041159659 8:55026575-55026597 CCACCTACAGGGTGTTCTTAAGC No data
Right 1041159662 8:55026593-55026615 TAAGCAGGCAACTCCACCATAGG No data
1041159660_1041159662 -8 Left 1041159660 8:55026578-55026600 CCTACAGGGTGTTCTTAAGCAGG No data
Right 1041159662 8:55026593-55026615 TAAGCAGGCAACTCCACCATAGG No data
1041159658_1041159662 -4 Left 1041159658 8:55026574-55026596 CCCACCTACAGGGTGTTCTTAAG No data
Right 1041159662 8:55026593-55026615 TAAGCAGGCAACTCCACCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041159662 Original CRISPR TAAGCAGGCAACTCCACCAT AGG Intergenic