ID: 1041161089

View in Genome Browser
Species Human (GRCh38)
Location 8:55044458-55044480
Sequence TGGTGTGGAAGGAGGGCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041161082_1041161089 -10 Left 1041161082 8:55044445-55044467 CCGGAGCCTGTCATGGTGTGGAA No data
Right 1041161089 8:55044458-55044480 TGGTGTGGAAGGAGGGCGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041161089 Original CRISPR TGGTGTGGAAGGAGGGCGGA GGG Intergenic
No off target data available for this crispr