ID: 1041162602

View in Genome Browser
Species Human (GRCh38)
Location 8:55060530-55060552
Sequence ATTCTCTTCTAGGGCTACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041162602_1041162608 11 Left 1041162602 8:55060530-55060552 CCCTTGTAGCCCTAGAAGAGAAT No data
Right 1041162608 8:55060564-55060586 CTTAAAATTAGGGATACAAAAGG No data
1041162602_1041162607 1 Left 1041162602 8:55060530-55060552 CCCTTGTAGCCCTAGAAGAGAAT No data
Right 1041162607 8:55060554-55060576 CTTAGAAATTCTTAAAATTAGGG No data
1041162602_1041162606 0 Left 1041162602 8:55060530-55060552 CCCTTGTAGCCCTAGAAGAGAAT No data
Right 1041162606 8:55060553-55060575 TCTTAGAAATTCTTAAAATTAGG No data
1041162602_1041162609 12 Left 1041162602 8:55060530-55060552 CCCTTGTAGCCCTAGAAGAGAAT No data
Right 1041162609 8:55060565-55060587 TTAAAATTAGGGATACAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041162602 Original CRISPR ATTCTCTTCTAGGGCTACAA GGG (reversed) Intergenic
No off target data available for this crispr