ID: 1041166337 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:55096355-55096377 |
| Sequence | CTTGAAGGTGGCCTAGAGGT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1041166337_1041166344 | 9 | Left | 1041166337 | 8:55096355-55096377 | CCTACCTCTAGGCCACCTTCAAG | No data | ||
| Right | 1041166344 | 8:55096387-55096409 | CTCTGTTACCTGCCTACCTAGGG | No data | ||||
| 1041166337_1041166343 | 8 | Left | 1041166337 | 8:55096355-55096377 | CCTACCTCTAGGCCACCTTCAAG | No data | ||
| Right | 1041166343 | 8:55096386-55096408 | GCTCTGTTACCTGCCTACCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1041166337 | Original CRISPR | CTTGAAGGTGGCCTAGAGGT AGG (reversed) | Intergenic | ||