ID: 1041166339

View in Genome Browser
Species Human (GRCh38)
Location 8:55096359-55096381
Sequence CCGCCTTGAAGGTGGCCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041166339_1041166343 4 Left 1041166339 8:55096359-55096381 CCTCTAGGCCACCTTCAAGGCGG No data
Right 1041166343 8:55096386-55096408 GCTCTGTTACCTGCCTACCTAGG No data
1041166339_1041166344 5 Left 1041166339 8:55096359-55096381 CCTCTAGGCCACCTTCAAGGCGG No data
Right 1041166344 8:55096387-55096409 CTCTGTTACCTGCCTACCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041166339 Original CRISPR CCGCCTTGAAGGTGGCCTAG AGG (reversed) Intergenic