ID: 1041166344

View in Genome Browser
Species Human (GRCh38)
Location 8:55096387-55096409
Sequence CTCTGTTACCTGCCTACCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041166334_1041166344 30 Left 1041166334 8:55096334-55096356 CCTTCATTCAGATACCTAATTCC No data
Right 1041166344 8:55096387-55096409 CTCTGTTACCTGCCTACCTAGGG No data
1041166336_1041166344 16 Left 1041166336 8:55096348-55096370 CCTAATTCCTACCTCTAGGCCAC No data
Right 1041166344 8:55096387-55096409 CTCTGTTACCTGCCTACCTAGGG No data
1041166342_1041166344 -6 Left 1041166342 8:55096370-55096392 CCTTCAAGGCGGTCTTGCTCTGT No data
Right 1041166344 8:55096387-55096409 CTCTGTTACCTGCCTACCTAGGG No data
1041166341_1041166344 -3 Left 1041166341 8:55096367-55096389 CCACCTTCAAGGCGGTCTTGCTC No data
Right 1041166344 8:55096387-55096409 CTCTGTTACCTGCCTACCTAGGG No data
1041166337_1041166344 9 Left 1041166337 8:55096355-55096377 CCTACCTCTAGGCCACCTTCAAG No data
Right 1041166344 8:55096387-55096409 CTCTGTTACCTGCCTACCTAGGG No data
1041166339_1041166344 5 Left 1041166339 8:55096359-55096381 CCTCTAGGCCACCTTCAAGGCGG No data
Right 1041166344 8:55096387-55096409 CTCTGTTACCTGCCTACCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041166344 Original CRISPR CTCTGTTACCTGCCTACCTA GGG Intergenic
No off target data available for this crispr