ID: 1041170439

View in Genome Browser
Species Human (GRCh38)
Location 8:55136481-55136503
Sequence TTGAGTAAGTAGTAGTATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041170436_1041170439 12 Left 1041170436 8:55136446-55136468 CCTCACACCAGCAAACTGTTATG 0: 1
1: 0
2: 0
3: 11
4: 117
Right 1041170439 8:55136481-55136503 TTGAGTAAGTAGTAGTATGTGGG No data
1041170437_1041170439 5 Left 1041170437 8:55136453-55136475 CCAGCAAACTGTTATGCACATGA 0: 1
1: 0
2: 0
3: 11
4: 121
Right 1041170439 8:55136481-55136503 TTGAGTAAGTAGTAGTATGTGGG No data
1041170435_1041170439 26 Left 1041170435 8:55136432-55136454 CCTTTAATTTTTTTCCTCACACC 0: 1
1: 0
2: 4
3: 51
4: 473
Right 1041170439 8:55136481-55136503 TTGAGTAAGTAGTAGTATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041170439 Original CRISPR TTGAGTAAGTAGTAGTATGT GGG Intronic
No off target data available for this crispr