ID: 1041171478

View in Genome Browser
Species Human (GRCh38)
Location 8:55146841-55146863
Sequence CTGTATCAAGGGACAGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 206}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041171478_1041171492 23 Left 1041171478 8:55146841-55146863 CCTTCTGCTGTCCCTTGATACAG 0: 1
1: 0
2: 1
3: 19
4: 206
Right 1041171492 8:55146887-55146909 GCAGCTGCTTCTGCCCACGCTGG No data
1041171478_1041171484 -6 Left 1041171478 8:55146841-55146863 CCTTCTGCTGTCCCTTGATACAG 0: 1
1: 0
2: 1
3: 19
4: 206
Right 1041171484 8:55146858-55146880 ATACAGATGCCCTTTGGGTAGGG No data
1041171478_1041171487 -1 Left 1041171478 8:55146841-55146863 CCTTCTGCTGTCCCTTGATACAG 0: 1
1: 0
2: 1
3: 19
4: 206
Right 1041171487 8:55146863-55146885 GATGCCCTTTGGGTAGGGGAGGG No data
1041171478_1041171483 -7 Left 1041171478 8:55146841-55146863 CCTTCTGCTGTCCCTTGATACAG 0: 1
1: 0
2: 1
3: 19
4: 206
Right 1041171483 8:55146857-55146879 GATACAGATGCCCTTTGGGTAGG No data
1041171478_1041171486 -2 Left 1041171478 8:55146841-55146863 CCTTCTGCTGTCCCTTGATACAG 0: 1
1: 0
2: 1
3: 19
4: 206
Right 1041171486 8:55146862-55146884 AGATGCCCTTTGGGTAGGGGAGG No data
1041171478_1041171488 0 Left 1041171478 8:55146841-55146863 CCTTCTGCTGTCCCTTGATACAG 0: 1
1: 0
2: 1
3: 19
4: 206
Right 1041171488 8:55146864-55146886 ATGCCCTTTGGGTAGGGGAGGGG No data
1041171478_1041171489 1 Left 1041171478 8:55146841-55146863 CCTTCTGCTGTCCCTTGATACAG 0: 1
1: 0
2: 1
3: 19
4: 206
Right 1041171489 8:55146865-55146887 TGCCCTTTGGGTAGGGGAGGGGG No data
1041171478_1041171485 -5 Left 1041171478 8:55146841-55146863 CCTTCTGCTGTCCCTTGATACAG 0: 1
1: 0
2: 1
3: 19
4: 206
Right 1041171485 8:55146859-55146881 TACAGATGCCCTTTGGGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041171478 Original CRISPR CTGTATCAAGGGACAGCAGA AGG (reversed) Intronic
900318127 1:2069563-2069585 CTGTCTCAAAGGACAGTAGGTGG + Intronic
900358191 1:2274809-2274831 CTGCAGCAAGGGGCAGCAGCCGG - Intronic
900779578 1:4609035-4609057 ATGTGCCCAGGGACAGCAGAGGG - Intergenic
902925854 1:19695258-19695280 CTGAAGCAATGGGCAGCAGAGGG - Intronic
903671673 1:25039585-25039607 CTGTGACAAGGGACAGCCGTCGG + Intergenic
904392528 1:30195430-30195452 CTGTATCCTGGGACAGCACCTGG + Intergenic
904479107 1:30783048-30783070 CTGGCTCCAGGGAGAGCAGAGGG - Intergenic
905487965 1:38319407-38319429 CTGTATTGAGGGACAAGAGAGGG - Intergenic
909337442 1:74492107-74492129 CTGCATCAAGTAACAGCAGTGGG + Exonic
909607358 1:77520574-77520596 CTGTATGAAGGGAGAGCATCAGG - Intronic
911513011 1:98830408-98830430 CTGAAACAAGTGACACCAGATGG + Intergenic
912849672 1:113112017-113112039 CTGGAACTAGGGAAAGCAGAAGG - Intronic
912852811 1:113141530-113141552 CTGAATCAAGGGACAGTAGGTGG + Intergenic
915444443 1:155966819-155966841 CTGTACCAAGGTCAAGCAGAAGG - Exonic
916831476 1:168496449-168496471 CAGTATCAAGTCACAGCAGCTGG - Intergenic
918073203 1:181148965-181148987 CTGGACCAAAGAACAGCAGAAGG + Intergenic
918585876 1:186187866-186187888 CGATATCTAGGGACAGCACAGGG - Exonic
920648464 1:207819992-207820014 CAGTGTCAAGGAACAGCTGAGGG + Intergenic
922189175 1:223302061-223302083 CTGTATCAGGAGACAGCACTAGG - Intronic
922602210 1:226865004-226865026 CTGGAGCAAGGGACAGCAGATGG + Intergenic
923062570 1:230489355-230489377 CTCTATCAAGAGACAGCACGAGG - Intergenic
923383716 1:233446626-233446648 CTGTAGGAAGGGACAGATGATGG + Intergenic
1063492794 10:6480405-6480427 TTATATCAAAGGACACCAGATGG + Intronic
1065162394 10:22936638-22936660 CTTTCTCATGGGAAAGCAGATGG + Intronic
1065456005 10:25907402-25907424 CTGAATCCAAGGACAGGAGAGGG - Intergenic
1067831745 10:49614541-49614563 CTCTATCCAGGGACAGCACCGGG + Intronic
1072289421 10:93949023-93949045 TTGTATCAAGGGAAAGAAGCAGG - Intronic
1074031133 10:109689620-109689642 GTGTATCAAGAGAGAGCAGAAGG - Intergenic
1076800935 10:132827869-132827891 CTGGATCAAGGGAGTGCACAGGG - Intronic
1077074999 11:696308-696330 CTGTACCCACAGACAGCAGAAGG - Intronic
1080087078 11:28296136-28296158 CTGTAACAAAGGACACCATATGG - Intronic
1080757955 11:35220212-35220234 CTGTCCCAAGGGAGAGCACAGGG + Intronic
1083513873 11:63237461-63237483 CTGTATCATCTCACAGCAGAAGG - Intronic
1083928008 11:65820652-65820674 CTGCTTCAAGGGTCACCAGAAGG + Intergenic
1084091294 11:66880765-66880787 CTGCAGCATGGGACCGCAGAGGG - Intronic
1084173119 11:67410039-67410061 CTGAGTCAAGGGACCCCAGAGGG + Exonic
1084721029 11:70905715-70905737 CAAGATCAAGGGCCAGCAGATGG - Intronic
1086996906 11:93368602-93368624 CTCTATCAAGAGACAGCACTAGG + Intronic
1087917767 11:103830750-103830772 CTGTATCATGTCACAGCAGAAGG - Intergenic
1087928974 11:103954312-103954334 TGGTATCAAGGGACAGGAGAGGG - Intronic
1091950655 12:4590432-4590454 CTGTATCAGGTGAGTGCAGACGG + Exonic
1092741073 12:11630165-11630187 CTGGCTCCTGGGACAGCAGATGG - Intergenic
1093055804 12:14554612-14554634 CTGGAGCAAGGGACAGGAGGAGG - Intronic
1093090823 12:14918330-14918352 ATGTACCAAAGGTCAGCAGAAGG + Intronic
1093439977 12:19183653-19183675 GTGTTTCAAGGAACAGCAGCTGG + Intronic
1094712799 12:32982676-32982698 CTCTATCAAAGGACAGCACTAGG + Intergenic
1100108585 12:91208972-91208994 CTGTATCAGGGGAAAAAAGAAGG - Intergenic
1101793917 12:107955649-107955671 CAGTATGAAAGAACAGCAGAAGG + Intergenic
1103748569 12:123143156-123143178 CTGTCTAGAGAGACAGCAGAGGG + Intronic
1103833533 12:123799966-123799988 GTGTTTCAAGGGAAGGCAGAAGG + Intronic
1104522203 12:129486210-129486232 ATGTAGCAAGGGACTGCAGCGGG - Intronic
1108359722 13:49658148-49658170 CTCTATCATGGGACAGCACTAGG + Intergenic
1111012395 13:82328952-82328974 TTGTAGCAAGGGACATCAGAAGG + Intergenic
1111277568 13:85969853-85969875 CTGTTTCAGGTGACAGCAAAAGG + Intergenic
1112018926 13:95354704-95354726 TTGTATCAACCAACAGCAGAAGG - Intergenic
1112645362 13:101325477-101325499 CAAAATCAAGGGACAGCAGCTGG - Intronic
1119642453 14:76325424-76325446 CTGCCTCAAGGGAAAGGAGACGG + Intronic
1119713939 14:76844912-76844934 CTGGAGGAAGGGACAGCAAAGGG + Intronic
1120473590 14:84958521-84958543 CTTTATAAAGAGACAGCAGATGG + Intergenic
1122116591 14:99530639-99530661 CAGGCCCAAGGGACAGCAGAGGG + Intronic
1123042716 14:105496933-105496955 CTGTATCCGGGGACTGCAGGCGG - Intronic
1123756804 15:23403295-23403317 CTGTCTCAAGGGACTGCTGTAGG + Intergenic
1126371899 15:47956136-47956158 CTGAATTGAGAGACAGCAGAAGG - Intergenic
1127293518 15:57591102-57591124 CTCTGTTAGGGGACAGCAGAGGG + Intergenic
1128374149 15:67064020-67064042 CTGAATCAAAGGGCAGCAGGCGG + Intronic
1128691909 15:69731038-69731060 CTGGAGCAAAGGCCAGCAGAAGG - Intergenic
1129337021 15:74858620-74858642 CTGTCTCCAGGGACACAAGATGG + Intronic
1129951291 15:79593911-79593933 CTGAATCAAGGGACAGATAAAGG + Intergenic
1131234277 15:90682607-90682629 CTGCATCAAGAGACAGATGAAGG - Intergenic
1132137132 15:99352184-99352206 CTGTATCAAGGGGCAGAACTAGG + Intronic
1134408626 16:13984527-13984549 ATAAATCAAAGGACAGCAGAAGG - Intergenic
1134459536 16:14419467-14419489 CTGTCTCAAGGGACTGCTGTAGG - Intergenic
1135623926 16:23979342-23979364 CAGCACCAGGGGACAGCAGAAGG - Intronic
1138193193 16:55033446-55033468 CTGGAACCAGGGACAGGAGAGGG - Intergenic
1139657977 16:68400483-68400505 ATTTATCAAGGGACAGAAGCTGG + Intronic
1142493677 17:294627-294649 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493716 17:294875-294897 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142493771 17:295233-295255 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493833 17:295616-295638 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493866 17:295834-295856 CTGCAGAAATGGACAGCAGAGGG + Intronic
1143754073 17:9053809-9053831 CTGTATGAAGGGCCAGCAAATGG + Intronic
1144491771 17:15718979-15719001 CTCTATCACGAGACAGCAGTAGG + Exonic
1144626018 17:16844843-16844865 CTGTCTTAAGGGACAGCAGGAGG + Intergenic
1144880416 17:18427877-18427899 CTGTCTTAAGGGACAGCAGGAGG - Intergenic
1144908709 17:18660226-18660248 CTCTATCACGAGACAGCAGTAGG - Exonic
1145029383 17:19493111-19493133 CTGGAGCAAGGGAAAACAGATGG + Intergenic
1145101503 17:20081274-20081296 CTGTATCTAGGCACTGCAGTAGG - Intronic
1145151819 17:20516510-20516532 CTGTCTTAAGGGACAGCAGGAGG + Intergenic
1146163188 17:30570782-30570804 CGGTTTTAAGGGACAGCAGGAGG + Intergenic
1146930944 17:36777414-36777436 CTGAATCAAGGAAGAGGAGAGGG + Intergenic
1147561306 17:41511056-41511078 CTGTATCCTGGGACCTCAGACGG - Intergenic
1147580170 17:41623541-41623563 CCGTCTTAAGGGACAGCAGGAGG + Intronic
1148138951 17:45314826-45314848 CTGTCTCAATGGACAGCACATGG - Intronic
1148760251 17:49996216-49996238 GTGTATCATGGGACAGCACTGGG + Intergenic
1155633526 18:27923384-27923406 CTGTTTTAAGGGTGAGCAGATGG + Intergenic
1157469673 18:47979587-47979609 CTGTCTCAAGGGCTGGCAGAGGG - Intergenic
1157566041 18:48679965-48679987 CTGTATGTAGGGAGAGCAGTTGG + Intronic
1158353736 18:56593282-56593304 CTGTATCACAAGACAGCAAAGGG + Intergenic
1161748858 19:6079482-6079504 CTATAGAAAGGGACAGCAGATGG + Intronic
1163567462 19:18059932-18059954 CTGTATCCAGGGCCAGCTCAGGG + Exonic
1164475712 19:28574441-28574463 CTCTATCATGAGACAGCAGTAGG - Intergenic
1164702155 19:30293289-30293311 CTGTATCAAGAAATATCAGAAGG - Intronic
1166408824 19:42542827-42542849 CAGTATCAAGGGACACCTGCAGG + Intronic
925654559 2:6131849-6131871 TTTTAACAAGGGACAGAAGATGG + Intergenic
925999511 2:9319095-9319117 CTGTTTAAGGGGGCAGCAGACGG + Intronic
931587692 2:63846116-63846138 CTGGAGCAAGGAAGAGCAGAAGG - Intronic
932164067 2:69489923-69489945 CAGTATCACGAGACAGCAGTTGG + Intronic
933058089 2:77699067-77699089 CTTTTTCTAGGGACAGCTGAAGG - Intergenic
933656645 2:84894143-84894165 CAGTATACAGGGAGAGCAGAAGG + Intronic
935194426 2:100803967-100803989 CTCCATCTATGGACAGCAGAGGG + Intergenic
937077871 2:119120106-119120128 ATGTGTCAGGGGAGAGCAGAAGG + Intergenic
937989794 2:127655824-127655846 CTGTTTCAAGGTAGAGCTGATGG - Intronic
938381645 2:130839471-130839493 CTGTACCAAGTGCCACCAGAAGG - Intronic
938635999 2:133226839-133226861 CTGTAACAAAGTACTGCAGATGG - Intronic
939227377 2:139380912-139380934 CTCTATCCATGGACAGCAGCTGG - Intergenic
940322174 2:152389307-152389329 CTATATGAAGATACAGCAGAAGG - Intronic
941512074 2:166424438-166424460 CTGTATCAACAAAGAGCAGATGG + Intronic
943262314 2:185681868-185681890 CTATATCAAGGGACTGAGGAGGG - Intergenic
943290458 2:186064628-186064650 CTGTATCACGAGACAGCACTAGG - Intergenic
944355163 2:198778891-198778913 CTGCATCCAGGGAGAGCTGATGG - Intergenic
946804663 2:223459865-223459887 CTGAGTCAAAGCACAGCAGAAGG + Intergenic
948863635 2:240764595-240764617 CTGTCTTAGGGGAAAGCAGAGGG - Intronic
949058556 2:241943288-241943310 CTGCAGAAAGGGACTGCAGAGGG - Intergenic
1170795169 20:19540800-19540822 CTATATAAAGGGACGGAAGATGG - Intronic
1171302240 20:24073664-24073686 CTGTATCAAAGCACATCAGGAGG + Intergenic
1172967288 20:38845995-38846017 CTGTGTCAAGTGACAGAGGAGGG + Intronic
1173350964 20:42245168-42245190 CACTATCTAGTGACAGCAGAAGG + Intronic
1173436370 20:43035332-43035354 CTGTATCAGAGGTCAGCAAAAGG + Intronic
1175400607 20:58698026-58698048 CTGTGTCAAGTGACAGCACTAGG + Intronic
1175738969 20:61407054-61407076 CTGTATCCAGGCAGAGCAGATGG - Intronic
1178162169 21:29930891-29930913 CTGTATCAAGGGAAACAAAAAGG - Intronic
1178626309 21:34221760-34221782 CTGTCTCAACAGACAACAGAGGG - Intergenic
1179224721 21:39443559-39443581 CTCTATGAAGTGACAGCACAAGG + Intronic
1179620604 21:42613372-42613394 CTCTATCAAGAGACAGCACCGGG + Intergenic
1180950773 22:19719505-19719527 CGGTATGAGGAGACAGCAGAGGG - Intronic
1183171937 22:36194727-36194749 CTGTGTCCTGGGTCAGCAGAAGG + Intronic
1183367180 22:37412938-37412960 CTGTGTCAAGGGAAGGGAGAGGG - Intronic
1184648953 22:45910919-45910941 CTGGAGCAGGGGACAGAAGAGGG - Intergenic
950500681 3:13361677-13361699 CTGTTTGAAGGGAGAGTAGATGG - Intronic
950702131 3:14757918-14757940 TTGTCTCAAGGGTCAGAAGAGGG - Intronic
950797267 3:15520420-15520442 TTTTATCAATGGACAGCAGTTGG + Intronic
955504905 3:59622206-59622228 CTGTATCAAAACACAGTAGAAGG - Intergenic
955731379 3:61991130-61991152 ATGAATCAAGGTACAGGAGAGGG - Intronic
960268377 3:115647564-115647586 CAGTATGAAGGGAGAGTAGAAGG + Intronic
963161249 3:142152553-142152575 CAGTATCCAGTGCCAGCAGAGGG - Intergenic
965222809 3:165950041-165950063 CTGTGTCAGGGAACACCAGAAGG - Intergenic
966060637 3:175749928-175749950 CTGTATCAAGGGTGTTCAGAAGG + Intronic
967903025 3:194476599-194476621 CTGAATCAAGGCAAAGCTGATGG - Intronic
967939930 3:194757761-194757783 CTGTATCTAGGGAAGGCTGAGGG + Intergenic
968607803 4:1543730-1543752 GTGTCTCAAGGGGCAGCAGGAGG + Intergenic
968969872 4:3788199-3788221 CTGTGTCCAGAAACAGCAGAGGG - Intergenic
969550430 4:7862708-7862730 ATGTTTCAAGGGATAGCAGAGGG - Intronic
969686874 4:8680483-8680505 GTGGAGCAAGGGGCAGCAGAGGG + Intergenic
969707518 4:8820042-8820064 CTGTTTCCATGGCCAGCAGAGGG + Intergenic
975954195 4:79816882-79816904 CTGACTCCAAGGACAGCAGAAGG + Intergenic
979320197 4:119314540-119314562 CTGTATCCTTGGCCAGCAGATGG + Intergenic
980063286 4:128155277-128155299 CTGTGTGAAGGCACAGTAGAGGG + Intronic
980749876 4:137074959-137074981 CTGCCTCAAGGGACTACAGATGG - Intergenic
980902298 4:138916530-138916552 CTGCAGCAAGGAACTGCAGATGG - Intergenic
983106897 4:163697676-163697698 CTGTGTCTAAGGACAGGAGATGG + Intronic
986194317 5:5524164-5524186 CTGAATCAAGGTCCAGGAGAAGG - Intergenic
990296636 5:54408044-54408066 CTGTATTAAAAAACAGCAGAAGG - Intergenic
993378365 5:87176657-87176679 AGGTGTCAAGGGACAGCAAAGGG - Intergenic
995245549 5:109931405-109931427 CTGTGACAAGGGACAGCAATAGG - Intergenic
995429565 5:112059026-112059048 CTATATCAAGAAACTGCAGATGG + Intergenic
1000535375 5:162471981-162472003 ATTTATCTAGGTACAGCAGAAGG - Intergenic
1001317094 5:170651326-170651348 CTGTATCAGGGGAAGGCAGGTGG + Intronic
1003891217 6:10565376-10565398 TGGGATCAAGGGAAAGCAGAGGG + Intronic
1004069339 6:12283847-12283869 CTGTGGCAAAGGACAGCACATGG - Intergenic
1008062548 6:47013790-47013812 CTGTATCATGAGACAGCACTTGG - Intronic
1008988727 6:57577934-57577956 CTGGATCTTGGAACAGCAGAAGG - Intronic
1009177328 6:60476494-60476516 CTGGATCTTGGAACAGCAGAAGG - Intergenic
1009286418 6:61824300-61824322 CTCTATCACGAGACAGCACAAGG - Intronic
1010878485 6:81138586-81138608 CTGTTTCCTGGGACAACAGAAGG - Intergenic
1011454309 6:87530745-87530767 CTGCATCATGGGAAAGCAGAAGG + Intronic
1012956201 6:105572793-105572815 CAGGATCAAAGGACAGCAGGGGG + Intergenic
1013585199 6:111572224-111572246 CTGTGTCAAGGGACTGCAGGGGG + Intronic
1013990829 6:116252659-116252681 CAGTATGAAGAGAAAGCAGATGG + Exonic
1014867817 6:126553425-126553447 CTGTAGAAAGGGACAACACAAGG - Intergenic
1017643694 6:156518611-156518633 CTGCATCATGGGCCAGCACAGGG + Intergenic
1018501218 6:164412914-164412936 TAGTATGAAGGGACAGCTGAAGG + Intergenic
1019141168 6:169944502-169944524 CTGCATAATGGGACACCAGAAGG + Intergenic
1019975682 7:4579448-4579470 CTCTATCACGGGACAGCACCAGG - Intergenic
1020432789 7:8130654-8130676 CTGTATAAAGCGACTGTAGAAGG - Intronic
1024288342 7:47780218-47780240 ATCTATAAAAGGACAGCAGAAGG - Intronic
1024550535 7:50559269-50559291 CTGTGTTGAGAGACAGCAGAGGG - Intronic
1024943804 7:54788840-54788862 CTGCATCATGTGACAGCAGGTGG - Intergenic
1026226208 7:68443721-68443743 CTGGACCAAGAGACGGCAGAAGG - Intergenic
1026481556 7:70784034-70784056 GTGGATCAAGGGACAACTGAAGG + Intronic
1026675694 7:72426170-72426192 CTGGATGAAGGGCCAGAAGAAGG + Intronic
1031018155 7:116597764-116597786 CTCTGTCAAGGAAGAGCAGAAGG + Intergenic
1031343947 7:120641350-120641372 CTGTCTCCAGGGACACTAGAGGG - Intronic
1033600228 7:142883991-142884013 CGATATCAGGGGAGAGCAGAGGG - Intronic
1036026729 8:4917230-4917252 CTCTATCATGAGACAGCAGTAGG + Intronic
1038424945 8:27458904-27458926 GTGCATCAAGGGACATCTGAGGG - Exonic
1038601141 8:28943816-28943838 CTGTATCAAGGGATTACATAAGG + Intronic
1038684938 8:29707884-29707906 CTGTATCAAGGGAGACCACATGG - Intergenic
1040633884 8:49249417-49249439 CTGGATCAAATAACAGCAGATGG - Intergenic
1041171478 8:55146841-55146863 CTGTATCAAGGGACAGCAGAAGG - Intronic
1043175231 8:77016785-77016807 CTGTAACATGGGACCCCAGAAGG - Intergenic
1043373025 8:79614050-79614072 CTGTATCAAGAATCAGCAGTTGG - Intronic
1043579610 8:81697212-81697234 CTCTATCATGGGACAGCACTAGG - Intergenic
1044958492 8:97506133-97506155 CTGTATCAAAGGGAGGCAGAGGG + Intergenic
1045436269 8:102168094-102168116 CTGTTTCAAGGAACAGGGGAAGG - Intergenic
1046747988 8:117896648-117896670 CTGTGTGAAGGGGCAGCAGGTGG - Intronic
1046880580 8:119302845-119302867 CTGTTTTAAGGGACAGAAAATGG - Intergenic
1048438087 8:134436268-134436290 CTGTATCATAGCACAGCAGAAGG + Intergenic
1049309432 8:141925497-141925519 CTGTGTCAAGGGCCTGCTGAGGG - Intergenic
1049683981 8:143931957-143931979 CTGTATCGAGGCACACCTGAAGG - Exonic
1053200245 9:36147320-36147342 CTGGACCTAGGGAGAGCAGAGGG - Intronic
1056764018 9:89433750-89433772 GTGTGTAATGGGACAGCAGAGGG - Intronic
1059165461 9:112072866-112072888 CTGTACCACAGGTCAGCAGAGGG - Intronic
1060200016 9:121646737-121646759 CTTTGTCAAGGGACAGGAGGAGG - Intronic
1060931231 9:127490796-127490818 CTGTTGCAGGGGAGAGCAGAGGG - Intronic
1185633425 X:1534581-1534603 CTGCCTCTAGGGACAGAAGAGGG + Intronic
1187926138 X:24252021-24252043 ATGGCTAAAGGGACAGCAGAAGG - Intergenic
1189602534 X:42642484-42642506 CTGGGACAAGGGACAGAAGATGG + Intergenic
1190308516 X:49100802-49100824 CTGTATCCAGAGACCACAGAGGG + Intronic
1190393702 X:49958090-49958112 CTATATAAAGGGACAGCAAAAGG - Intronic
1192428329 X:71096351-71096373 CTGTGTGAAGGGACAGCTTAGGG + Exonic
1192865787 X:75130697-75130719 CTGGGTCAAGGGATAACAGATGG + Intronic
1195682605 X:107560125-107560147 CTAGATCAAGGGACAGAGGAAGG - Intronic
1197828811 X:130619668-130619690 CTGTATCAGAAGACAGTAGAAGG + Intergenic
1199318557 X:146410858-146410880 CTGGATCAAGAGACAGAAGGGGG + Intergenic
1199718659 X:150525840-150525862 GTGAGTCAAGGGACAGCACAGGG + Intergenic
1200354603 X:155534952-155534974 TTATAACAAGGGACAGGAGATGG + Intronic