ID: 1041172679

View in Genome Browser
Species Human (GRCh38)
Location 8:55161051-55161073
Sequence AAAGCCGAAGCTCAGAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041172679_1041172683 15 Left 1041172679 8:55161051-55161073 CCTGTGTTCTGAGCTTCGGCTTT 0: 1
1: 0
2: 0
3: 8
4: 111
Right 1041172683 8:55161089-55161111 CATTGAGTATTGCCAGCACCTGG No data
1041172679_1041172684 26 Left 1041172679 8:55161051-55161073 CCTGTGTTCTGAGCTTCGGCTTT 0: 1
1: 0
2: 0
3: 8
4: 111
Right 1041172684 8:55161100-55161122 GCCAGCACCTGGACCTGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041172679 Original CRISPR AAAGCCGAAGCTCAGAACAC AGG (reversed) Intronic
901013517 1:6214293-6214315 AAAGTGAAATCTCAGAACACTGG - Intronic
902706960 1:18212251-18212273 GAAACTGAAGCTCAGAACAGTGG + Intronic
903111216 1:21135881-21135903 AAAGCAGAAACAAAGAACACAGG + Intronic
905454093 1:38075770-38075792 AAAGCCCCAGCTCAGAACTATGG + Intergenic
906510534 1:46408123-46408145 AGAGCCTCAGCTCAGAAGACAGG + Intronic
908102954 1:60810174-60810196 AAAGTAGATGCTCAAAACACAGG - Intergenic
914713528 1:150235674-150235696 AAATCCGATCCTCAGAATACTGG + Intronic
918903914 1:190465396-190465418 AATGCAGAAGCTCAGAAGTCAGG - Intronic
920186381 1:204161834-204161856 AAAGCCTGAGCACAGAAGACAGG - Intronic
922890630 1:229059052-229059074 AAAGCAGAAACTCAGACCACAGG + Intergenic
1064247599 10:13681678-13681700 AAAGCCAAAGCTCACACCAGTGG + Intronic
1068506033 10:57900283-57900305 AAAGCTGAAGTGCAGAGCACTGG + Intergenic
1071792079 10:88965593-88965615 AAAGCCAATGCACAGAACAGAGG + Intronic
1074521258 10:114226440-114226462 AAAACCGAATCTCTGAACCCTGG - Intronic
1076787621 10:132758871-132758893 AAACCCGACGCTCAGGAGACAGG - Intronic
1081720847 11:45286922-45286944 GAAGCCGAGGCTCAGAAGAGAGG + Intergenic
1088007235 11:104956804-104956826 AAAACAGAAGCCCAGAACTCAGG - Intronic
1088146552 11:106687497-106687519 AAAGCACAAGCCCAGAACATGGG - Exonic
1088355110 11:108934801-108934823 AAAGCCAAAATTTAGAACACTGG + Intronic
1092529518 12:9332804-9332826 AAAGCCGAAGGACAGAGCCCAGG - Intergenic
1099411094 12:82329084-82329106 AAAGCCGTTGCTCTGAGCACAGG - Intronic
1100156085 12:91802046-91802068 ATAGCTGAAGCTCAGGAGACAGG + Intergenic
1105605337 13:21921995-21922017 AAAGTCGCTGCTCAGAACCCAGG + Intergenic
1115733509 14:36297643-36297665 CAAGCCGAGGCTCTGAAGACAGG + Intergenic
1122016858 14:98803641-98803663 AAAGCCAGTGCTCATAACACAGG - Intergenic
1124924552 15:34058662-34058684 AAAGCAGAAGCAAAGAACAAGGG - Intronic
1126669004 15:51099332-51099354 GAAGCAGAAGCTAAGAACCCAGG - Intronic
1131080261 15:89528779-89528801 AAAGTCCAAGATCAAAACACTGG + Intergenic
1133281286 16:4666876-4666898 AGAGCAGACACTCAGAACACTGG + Intronic
1133693389 16:8237360-8237382 AAAGCAGAAGCTCAGCAAATAGG + Intergenic
1134748315 16:16605147-16605169 AACGCCCATGCTCAGACCACAGG - Intergenic
1134997148 16:18748468-18748490 AACGCCCATGCTCAGACCACAGG + Intergenic
1135046192 16:19157902-19157924 GAAACCGAGGCTCAGAAAACTGG + Intronic
1138102573 16:54265548-54265570 AAAGCAAGAGCTCTGAACACAGG - Intronic
1138387081 16:56643279-56643301 AGAGCCGAAGCTCACGTCACTGG + Intronic
1144064374 17:11611457-11611479 AAAGCCTGAGCTGGGAACACAGG - Intronic
1144074198 17:11702143-11702165 AGAGCCCAGGCTCAGAAGACAGG + Intronic
1144459063 17:15443029-15443051 AAAGCCCAAGTTCAGACTACTGG + Intronic
1144826061 17:18106343-18106365 ACACCCAAAGCTCAGGACACAGG - Intronic
1144967486 17:19087255-19087277 ATATCAGAAGCTCAGAACTCTGG - Intergenic
1144980433 17:19164810-19164832 ATATCAGAAGCTCAGAACTCTGG + Intergenic
1144987789 17:19213422-19213444 ATATCAGAAGCTCAGAACTCTGG - Intergenic
1145032344 17:19514057-19514079 AAAGCAAAATCTCAGAACACCGG + Intronic
1146485853 17:33241954-33241976 AAAACCCAATCTCAAAACACTGG + Intronic
1149340126 17:55676749-55676771 AAAGAGGAAGATCATAACACAGG + Intergenic
1152063059 17:78093576-78093598 GAAGCCACAGATCAGAACACCGG - Intronic
1153463084 18:5358832-5358854 CAAGCTGAAGCTCAGAAATCTGG - Intergenic
1158585197 18:58726938-58726960 AAAGCCAAAGCTTTGAACCCAGG - Intronic
1165152043 19:33766648-33766670 GGAGCCGAAGCTCAGAATCCGGG + Intronic
1167476131 19:49702277-49702299 AAGGGTGAAGCTCAGAATACTGG - Intronic
1167735298 19:51290870-51290892 AAAGCCCAAGATCACAGCACTGG - Intergenic
925112659 2:1349570-1349592 ACAGGCCCAGCTCAGAACACAGG - Intronic
927451009 2:23209626-23209648 AAAGTCCAAGCTGAGAAGACTGG - Intergenic
930662246 2:54065910-54065932 AAAGAAGAGGCTCTGAACACCGG - Intronic
931757040 2:65383600-65383622 AAAGCCTTATCTCAGAACATAGG - Intronic
932061446 2:68503768-68503790 AAAGTAGAAGCACAGATCACTGG - Intronic
940345378 2:152623080-152623102 TAAGCCTGAGATCAGAACACAGG - Intronic
948161548 2:235828935-235828957 AAAACTGAGGCTCAGAACTCTGG - Intronic
1170051915 20:12155553-12155575 AAAGTCCAAGCTATGAACACAGG + Intergenic
1173062850 20:39678942-39678964 AAAGCAGCAGCTGAGAACATGGG - Intergenic
1173124624 20:40325276-40325298 AAAACCAGAGCTCAGAAGACTGG + Intergenic
1173395423 20:42675089-42675111 AAAGGTGTGGCTCAGAACACAGG - Intronic
1175701291 20:61139201-61139223 AAAGACTTAGCTCAGAACTCAGG + Intergenic
1179250729 21:39669305-39669327 AAAGCCAAAGCTCAGAAAAATGG + Exonic
1179659661 21:42866160-42866182 CAAGCCGAAGATGAGGACACAGG - Intronic
1182718650 22:32379387-32379409 AAAGCCACTGCTCAGAGCACAGG - Intronic
1183019953 22:35019032-35019054 ACAGCATCAGCTCAGAACACGGG - Intergenic
1183098963 22:35571640-35571662 AATCTCAAAGCTCAGAACACTGG + Intergenic
1184569329 22:45311820-45311842 AAAGCCCAGGCCCAGAAGACTGG + Intronic
951522154 3:23620200-23620222 GAAGCAGAAGCACAGAACACTGG + Intergenic
953294476 3:41700174-41700196 AAACCCTAAGCTCTGAAAACAGG + Intronic
953911204 3:46893880-46893902 CAAGCCGAAGGTCAGACCACAGG - Intronic
955395971 3:58557701-58557723 AAAGCAGTAGCTTAGAACTCTGG + Intergenic
956855162 3:73268907-73268929 GAAGCTGAAGCTCAGAAAGCTGG - Intergenic
959047811 3:101493888-101493910 AATTCAGAAGCTCAGAACGCTGG - Exonic
959650404 3:108745360-108745382 GCAGCCTAAGCTCAGCACACAGG + Intronic
960245831 3:115399550-115399572 GAAGGTAAAGCTCAGAACACAGG - Intergenic
961183017 3:124890816-124890838 AAAGCAAAAGCTCAGAGCAAAGG - Intronic
961421943 3:126813214-126813236 AAAGCCAAGGCTCAGAAAAGGGG - Intronic
967834811 3:193952087-193952109 GAAGCAGAAGCTCAAAAGACAGG - Intergenic
972231517 4:37078001-37078023 AAACCCAAAACTTAGAACACTGG - Intergenic
972489099 4:39570055-39570077 AAAGCAGTGGCTCAGAACTCTGG - Intronic
974304355 4:60113267-60113289 AAAGCCTAAGGATAGAACACTGG + Intergenic
975034924 4:69668246-69668268 AAAGCTGAAGTTCAGAACAATGG + Intergenic
975613397 4:76222895-76222917 CAAGCTGAAGCTCAGAAGAAAGG + Intronic
980136042 4:128859664-128859686 AAATTCTACGCTCAGAACACCGG - Intronic
982368174 4:154603506-154603528 AAAGCCAAAGCTCAGGACTTCGG + Intergenic
985012938 4:185602348-185602370 AAAGCAGATGCTCAGAAGACTGG + Intronic
985588727 5:753958-753980 ACAGCCGGGGCTCAGCACACGGG + Intronic
985603394 5:846397-846419 ACAGCCGGGGCTCAGCACACGGG + Intronic
987480431 5:18449449-18449471 AAAGCAGAAGCTCATAATATTGG - Intergenic
989786681 5:45340579-45340601 AAAGCAGAATTTCAGGACACTGG - Intronic
1004989372 6:21119745-21119767 AGAGCCCAAGCTCACAACAGAGG - Intronic
1005793564 6:29332557-29332579 AATTAGGAAGCTCAGAACACTGG + Intergenic
1009454979 6:63845949-63845971 AACGCAGAAGCTCAGAATTCAGG + Intronic
1010121113 6:72377138-72377160 CAAGCCCAAGCACAGAACTCTGG - Intronic
1012627818 6:101425845-101425867 AAAACTGATGCTCAGAAGACAGG - Intronic
1015421423 6:133013869-133013891 AAAGCCCAAGATCAAAACAATGG - Intergenic
1018510030 6:164515292-164515314 AAAGCAGAATATGAGAACACAGG - Intergenic
1019303974 7:323645-323667 AAAGCAGAGGCAAAGAACACAGG - Intergenic
1020403972 7:7810654-7810676 AAATTGGAAGATCAGAACACTGG - Intronic
1022393677 7:29965641-29965663 AAAGAGGCAGCTCAAAACACAGG + Intronic
1032443588 7:131961168-131961190 ACAGCCGAAGCTGGTAACACTGG - Intergenic
1032490815 7:132322852-132322874 GAAGCCGAACCCCAGAACAGTGG - Intronic
1032765274 7:134986268-134986290 ACAGCCGAAGTGCAGACCACTGG + Intergenic
1038778279 8:30550169-30550191 AAAGGCGCAGCTCAGAGCACAGG - Intronic
1040592558 8:48806862-48806884 AATGCCCAAAGTCAGAACACTGG - Intergenic
1041172679 8:55161051-55161073 AAAGCCGAAGCTCAGAACACAGG - Intronic
1043364523 8:79517150-79517172 AAAACCTAGGCTCAGAACATAGG - Intergenic
1047201341 8:122770227-122770249 ACAGCTGGAGCTCAGCACACTGG - Intergenic
1048735087 8:137490273-137490295 ACAGCCGAACTTCAAAACACAGG - Intergenic
1049193010 8:141299151-141299173 GAAGCAGAAGCTCCGAGCACTGG + Intronic
1051520439 9:17981219-17981241 AAAGTCCAAGATCACAACACTGG - Intergenic
1188973081 X:36640724-36640746 AAAGCCAAAGTTCATAACAGAGG - Intergenic
1190741583 X:53292282-53292304 AAAGCCCAAGCTTGAAACACAGG + Intronic
1190872970 X:54440327-54440349 CAAGCCGAGCCTGAGAACACAGG - Intergenic
1194405089 X:93487019-93487041 AAAACTGAAGTTCAGAAAACAGG - Intergenic
1196468647 X:115999098-115999120 AAAGTAGAAGCCCAGAATACAGG + Intergenic
1196871943 X:120120811-120120833 AAAGAGAAAGATCAGAACACTGG - Intergenic
1198537500 X:137600960-137600982 AGAGCTGAAGCTCTGACCACTGG - Intergenic